|
| Status |
Public on Dec 25, 2013 |
| Title |
E14.JARID2.RNAse.190k.b1 |
| Sample type |
SRA |
| |
|
| Source name |
E14 embyonic stem cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: E14 embyonic stem cells
ip antibody: JARID2
antibody source: in-house
antibody lot #: PC-11
excised band size: 140–220 kDa
limited rnase treatment: yes
|
| Treatment protocol |
cells were pulsed with either 100 µM 4-SU for 16h (JARID2 PAR-CLIP) or 500 µM 4-SU for 2h (EZH2 PAR-CLIP)
|
| Growth protocol |
E14 cells were grown in standard ESC conditions including 15% ESC certified serum
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Whole cell extracts were obtained by incubating the cells for 10 min at 37C in an appropriate volume of CLIP buffer (20 mM HEPES pH 7.4, 5 mM EDTA, 150 mM NaCl, 2% lauryldimethylbetaine) supplemented with protease inhibitors, 20 U/ml Turbo DNase (Life technologies), and 200 U/ml murine RNase inhibitor (New England Biolabs).
After clearing the lysate by centrifugation, immunoprecipitations were carried out in the same CLIP buffer for 1 hour at 4C, after which, when required, the extracts were treated with various concentration of RNAse A + T1 cocktail (Ambion) for 5’ at 37C. Immunocomplexes were recovered by adding protein G-coupled dynabeads (Life technologies) for 45 min at 4C. Contaminating DNA was removed by treating the beads with Turbo DNase (2U in 20 μl). Crosslinked RNA was labeled by successive incubation with 5U Antarctic phosphatase (New England Biolabs) and 5U T4 PNK (New England Biolabs) in presence of 10 μCi [γ-32P] ATP (PerkinElmer, MA). Labeled material was resolved on 8% bis-tris gels, transferred to nitrocellulose membranes and exposed to autoradiography films for 1–24 hours.
100 pmol of a 3’-blocked DNA adapter were ligated to the RNA after dephosphorylation and before 5’ labeling by incubating the beads with T4 RNA ligase 1 (New England Biolabs) for 1 hour at 25C. After autoradiography, bands of interest were excised and the RNA eluted from the membrane by treating with proteinase K for 30’ at 37C and then proteinase K in presence of 3.5M urea for 30’ at 55C. Custom designed 5’ RNA adapters were ligated, the products size-selected on polyacrylamide or agarose gels.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
crosslinked RNA
|
| Data processing |
Library strategy: PAR-CLIP-Seq
3' adapter (TTGATATAAATAGTGCCCATGGATC) trimmed with fastx_clipper
mapped to the mm9 genome using BOWTIE allowing for up to two mismatches and removing optical/PCR duplicates
putative RNA-binding sites identified with PARalyzer software (Corcoran et al., 2011) requiring at least two T->C conversions per RCS
Genome_build: mm9
Supplementary_files_format_and_content: BED files containing all unfiltered RCSs
|
| |
|
| Submission date |
Jul 03, 2013 |
| Last update date |
Feb 04, 2022 |
| Contact name |
Roberto Bonasio |
| Organization name |
University of Pennsylvania
|
| Department |
Cell and Developmental Biology
|
| Lab |
Bonasio
|
| Street address |
3400 Civic Center Blvd - SCTR 9-111
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL13112 |
| Series (2) |
| GSE48517 |
PAR-CLIP for JARID2 in mouse embryonic stem cells |
| GSE48518 |
Interactions between JARID2 and noncoding RNAs regulate PRC2 recruitment to chromatin |
|
| Relations |
| BioSample |
SAMN02225360 |
| SRA |
SRX317617 |
