I. Labelling Protocol (VIB-MAF Cy3 Labeling v1 and VIB-MAF Cy5 Labeling v1) [1] RNA amplification by in vitro transcription This protocol has been published in L. G. Puskás, Á. Zvara, L. Hackler Jr., and P. Van Hummelen (2002). RNA amplification results in reproducible microarray data with slight ratio bias. Biotechniques (2002) vol. 32, no. 6 p.1330-1341. 1.1 Reagents: ------------ (1) RNase Out 40U/ul (Invitrogen, 5000U, Cat. No. 10777-019), (2) HT7T primer, HPLC purified (Eurogentec, sequence: 5 - GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGTTTTTTTTTT TTTTTTTTTTTTTT-3 ), (3) Trehalose 1.7 M (Sigma, Cat. No. T-5251), (4) 5 x first strand buffer (SuperScript II RT, Invitrogen, Cat. No. 18064-014), (5) 0.1 M DTT (SuperScript II RT, Invitrogen, Cat. No. 18064-014), (6) 10 mM dNTP-mix (Amersham Pharmacia Biotech, 100 mM, Cat. No. 27-2035- 01), (7) SuperScript II RT 200U/ul (Invitrogen, 10000U, Cat. No. 18064-014), (8) 5 x second strand buffer: 100 mM Tris-HCl (pH 6.9) (Invitrogen, Cat. No. 15714- 025 (Tris) and 1027 (HCl)), 450 mM KCl (Sigma, Cat. No. P-9541), 23 mM MgCl2 (Sigma, Cat. No. M 8266), 0.75 mM Beta-NAD+ (Sigma, Cat. No. N- 1636), 50 mM (NH4)2SO4 (Invitrogen, Cat. No. 15501-018)), (9) E. coli DNA Ligase 10U/ul (Invitrogen, 100U, Cat. No. 18052-019), (10) E. coli DNA Polymerase I 10U/ul (Invitrogen, 1000U, Cat. No. 18010-025), (11) E. coli RNase H 2U/ul (Invitrogen, 120U, Cat. No. 18021-071), (12) DEPC-water (Invitrogen, Cat. No. 10977-015), (13) Ethanol Absolut (VWR, Cat. No. 1.08543.0250), (14) QIAquick PCR Purification Kit (Qiagen, Cat. No 28106), (15) NaAc 3M, pH 5.0 (Sigma, Cat. No. S-2889), (16) AmpliScribeTM T7 Transcription Kit (Epicentre Technologies, Cat. No. AS3107), (17) RNeasy Mini Kit (Qiagen, Cat. No 74106). 1.2 Protocol First Strand Synthesis: ----------------------------------- (1) Mix 5 ug of total RNA (3 ul) with 1 ul of RNase Out 40U/ul. (2) Add 1 ul of (HT7T) primer 200 ng/ul and 6 ul of 1.7 M Trehalose heated to 42C. (3) Put on 75C for 5 minutes, chill on ice and spin down. (4) Add 4 ul of 5 x first strand buffer, 2 ul of 0.1 M DTT, 1 ul of 10mM dNTP-mix, 1 ul of 1.7 M Trehalose and 1 ul of SuperScript II RT. (5) Incubate at 37C for 5 minutes, at 45C for 5 minutes and then make 10 cycles of 60C for 2 minutes and 55C for 2 minutes. Go to 65C for 10 minutes and then go to 4C or chill on ice. 1.3 Protocol Second Strand Synthesis: ------------------------------------ (1) Add 33.4 ul of 5 x second strand buffer, 3.4 ul of 10 mM dNTP-mix, 1 ul of E. coli DNA Ligase (10U/ul), 4 ul of E. coli DNA Polymerase I (10U/ul), 1 ul of E. coli RNase H (2U/ul) and 103.8 ul of DEPC-water to the 20 ul of first strand mix. (2) Incubate at 16C for 3 hours, at 65C for 10 minutes and then go to 4C or chill on ice. (3) Purification with QIAquick PCR Purification Kit according to the manufacturers guidelines. 1.4 Protocol for In Vitro Transcription (IVT): --------------------------------------------- (1) Add 2 ul of 10 x T7 reaction buffer (heated to 42C), 6 ul of 25 mM rNTP-mix, 2 ul of 100 mM DTT and 2 ul of AmpliScribe T7 enzyme solution to the DNA from second strand synthesis. (2) Incubate at 37C for 3 hours, at 65C for 10 minutes and then go to 4C or chill on ice. (3) Purification with QIAgen RNeasy Mini Kit according to the manufacturers guidelines. (4) Check RNA concentration by OD. We recommend a 1/10 dilution in water or no dilution when using Nanodrop. Check A260/A280 ratio and determine the RNA concentration (1 OD = 40 ng/ul). [2] Labeling 2.1 Reagents: ------------ (1) RNase Out 40U/ul (Invitrogen, 5000U, Cat. No. 10777-019), (2) Random nonamers N9 1 ug/ul (Genset, 1862270), (3) 5 x first strand buffer (SuperScript II RT, Invitrogen, Cat. No. 18064-014), (4) 0.1 M DTT (SuperScript II RT, Invitrogen, Cat. No. 18064-014), (5) 10 mM dNTP/2 mM dCTP (Amersham Pharmacia Biotech, 100 mM, Cat. No. 272050/60/70/80), (6) CyTM-3-dCTP and CyTM-5-dCTP for microarrays (Amersham Pharmacia Biotech, 25 nmol, Cat. No. PA 53021 and PA 55021), (7) SuperScript II RT 200U/ul (Invitrogen, 10000U, Cat. No. 18064-014), (8) 2.5 M NaOH (Sigma, Cat. No. S-0899), (9) MOPS (3-(N-Morpholino)propanesulfonic acid) (Sigma, Cat. No. M-8899), (10) NaAc 3M, pH 5.0 (Sigma, Cat. No. S-2889), (11) QIAquick PCR Purification Kit (Qiagen, Cat. No 28106).
2.2 Cy3 labeling Protocol: ---------------------- (1) Mix 5 ug of RNA from IVT (8 ul), 0.5 ul of RNase Out 40U/ul, 5 ul spikes (not for Arabidopsis thaliana) and 2 ul of random nonamers N9 1 ug/ul. (2) Denaturate at 70C for 10 minutes, chill on ice and add the following components: 4 ul of first strand buffer, 1 ul of 10 mM dNTP/2 mM dCTP, 2 ul of 0.1 M DTT, 1.5 ul Cy3 dCTP and 1 ul of SuperScript II RT 200U/ul. (3) Incubate at 42C for 2.5 hours and then go to 4C or chill on ice. (4) Denaturate the RNA template by adding 2 ul of 2.5 M NaOH, incubating at 37C for exactly 15 minutes, adding 10 ul of 2 M MOPS and putting on ice. (5) Purification with QIAquick PCR Purification Kit according to manufacturers guidelines.
2.3 Cy5 Labeling Protocol: ---------------------- (1) Mix 5 ug of RNA from IVT (8 ul), 0.5 ul of RNase Out 40U/ul, 5 ul spikes (not for Arabidopsis thaliana) and 2 ul of random nonamers N9 1 ug/ul. (2) Denaturate at 70C for 10 minutes, chill on ice and add the following components: 4 ul of first strand buffer, 1 ul of 10 mM dNTP/2 mM dCTP, 2 ul of 0.1 M DTT, 1.5 ul of Cy5 dCTP and 1 ul of SuperScript II RT 200U/ul. (3) Incubate at 42C for 2.5 hours and then go to 4C or chill on ice. (4) Denaturate the RNA template by adding 2 ul of 2.5 M NaOH, incubating at 37C for exactly 15 minutes, adding 10 ul of 2 M MOPS and putting on ice. (5) Purification with QIAquick PCR Purification Kit according to manufacturers guidelines.
II. Hybridisation Protocol (VIB-MAF Automatic hybridization v1 using Automatic Slide Processor (ASP)) A. Reagents: ----------- (1) PolydT35 1 ug/ul (Genset), (2) Mouse COT-1 DNA (R) 1 mg/ml (Invitrogen, 500 ug, Cat. No. 18440-016), (3) Human COT-1 DNA (R)1 mg/ml (Invitrogen, 500 ug, Cat. No. 15279-011), (4) Microarray hybridization buffer (Amersham Pharmacia Biotech, Cat. No. RPK0325), (5) Formamide (Sigma, Cat. No. F-9037). Use Mouse COT DNA on Mouse slides, Human COT DNA on Human slides and no COT on Arabidopsis slides. B. Protocol for automatic hybridization with ASP: ------------------------------------------------ (1) Make 210 ul hybridization mixture per slide with 25% probe, 25% buffer and 50% formamide. (2) Dissolve the Cy3 and Cy5 sample together in 12 ul of polydT35, 30 ul of Mouse or Human or no (Arabidopsis) COT, water to make a total volume of 52.5 ul, 52.5 ul of Microarray 4x hybridization buffer and 105 ul formamide. (3) Denature at 96C for 3 minutes. (4) Keep on ice until hybridization. (5) Inject samples in ASP. III. Scanning Protocol (VIB-MAF scanning v1) A. Equipment: ------------ (1) Generation III Scanner, Amersham Biosciences (2) Scanner software: Default scanner software B. Scanning Protocol: -------------------- (1) Before scanning, adjust scanning parameters to: Full Slide, Cy5 PMT=550V, Cy3 PMT=550V Keywords = Thyroid Keywords = Adenosine Receptor 2a Lot batch = batch 36A, RPK 0331 ; Printed 24-Sep-2001
Gene Expression Profile in thyroid of Transgenic Mice over-expressing the Adenosine Receptor 2a
Data table header descriptions
ID_REF
CH1_NBC_INT
Channel 1 artifact-removed density value for each spot, multiplied by its area. Pixels with values exceeding a user-defined threshold value (default is 4.0 Median of Absolute Deviations) are excluded and are replaced with estimated values, derived by interpolation from neighboring pixels. This measure removes the influence of image artifacts (e.g., dust particles) on density estimation.
CH1_PCTREPARVOL
Channel 1 percent of pixels replaced with estimated values in the calculation of AR Volume.
CH1_MAD_RFU
Channel 1 median of Absolute Deviation -- Median of the absolute values of deviations from the median density (i.e., the absolute values of pixel densities median density). It is a measure of the variation around the median density value of the spot.
CH1_PIXEL_SD
Channel 1 deviation -- Standard deviation of the pixel density values.
CH1_SPOT_AREA
Channel 1 area -- Area of the spot.
CH1_BKGD
Channel 1 Background density or volume. Background volume value is adjusted to the size of spot, where applicable.
CH1_BC_INT
Channel 1 Subtracted artifact removed (AR) volume value. AR Volume value of the spot, minus the background Volume value. The background value is adjusted to the size of the spot when applicable.
CH1_SN
Channel 1 Signal-to-Noise Ratio -- Spot density minus Background density, divided by the SD of the Background density.
CH2_NBC_INT
Channel 2 artifact-removed density value for each spot, multiplied by its area. Pixels with values exceeding a user-defined threshold value (default is 4.0 Median of Absolute Deviations) are excluded and are replaced with estimated values, derived by interpolation from neighboring pixels. This measure removes the influence of image artifacts (e.g., dust particles) on density estimation.
CH2_PCTREPARVOL
Channel 2 percent of pixels replaced with estimated values in the calculation of AR Volume.
CH2_MAD_RFU
Channel 2 median of Absolute Deviation -- Median of the absolute values of deviations from the median density (i.e., the absolute values of pixel densities median density). It is a measure of the variation around the median density value of the spot.
CH2_PIXEL_SD
Channel 2 deviation -- Standard deviation of the pixel density values.
CH2_SPOT_AREA
Channel 2 area -- Area of the spot.
CH2_BKGD
Channel 2 Background density or volume. Background volume value is adjusted to the size of spot, where applicable.
CH2_BC_INT
Channel 2 Subtracted artifact removed (AR) volume value. AR Volume value of the spot, minus the background Volume value. The background value is adjusted to the size of the spot when applicable.
CH2_SN
Channel 2 Signal-to-Noise Ratio -- Spot density minus Background density, divided by the SD of the Background density.
