 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 24, 2015 |
| Title |
MCF7 control siScramble 1 |
| Sample type |
SRA |
| |
|
| Source name |
mammary gland/breast
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: MCF7
|
| Treatment protocol |
siScramble
|
| Growth protocol |
MCF-7cells were cultured in DMEM containing 10% FBS, penicillin and streptomycin at 37ºC and 5% CO2.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
RNA libraries were prepared for sequencing using standard Illumina protocols.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
(for ChIRP data) Adapter (GATCGGAAGAGCACACGTCTGAACTCCAGTCAC) sequences were clipped from 3' ends of reads (using cutadapt v1.1, parameters -O 12 -e 0.2 -m 12)
(for ChIRP data) Data was aligned to the human genome using bowtie2 (v. 2.0.6) using parameters “--seed 42 -N 1”.
(for ChIRP data) Peak detection was run using macs2 (v. 2.0.10.20130501)using parameters “ -g hs -B -p 0.1”. Peaks with a -log10(q-value) >= 5 and an enrichment >= 4 with respect to the input were kept, and peaks found in the odd and even samples were intersected. Overlapping peaks in both samples that had a position-wise Pearson correlation of abundance >= 0.2 and at least 25 reads in both samples were merged.
(for GROseq data) The first 6 nucleotides (index sequences) were clipped from reads. rRNA reads were removed from the data by alignment to a rRNA index compiled from Ensembl annotations (“rRNA”, “rRNA_pseudogene” and “Mt_rRNA”) using bowtie2 (v.2.0.6, parameters “--seed 42 --end-to-end -N1 -L20 -i C,1 -D5 -R5”) and keeping the unmapped reads.
(for GROseq data) Data was aligned to the human genome using bowtie2 (v. 2.0.6) using parameters “--seed 42 --sensitive”.
A transcript annotation was assembled by merging annotations from Ensembl (v. 37.65), RefSeq (obtained from UCSC Tables 9AUG2012) and the Broad lincRNA catalog (doi:10.1101/gad.17446611), using gffread (supplied with cufflinks) parameters (-M -L -F -G -T).
(for samples “MCF7 control siScramble 1”, “MCF7 control siScramble 2”, “MCF7 nutlin siScramble 1”, “MCF7 nutlin siScramble 2”, “MCF7 control totalRNA”, “MCF7 nutlin totalRNA”) Data was aligned using TopHat (v.2.0.3, parameters “-m1 -F0.0 --segment-length 21 --segment-mismatches 1”) in conjunction with bowtie2 (v.2.0.0-beta6) and the aforementioned transcript annotations.
(for all other RNAseq samples) Data was aligned using TopHat (v.2.0.7, parameters “-m1 -F0.0 --segment-length 25 --segment-mismatches 1 --no-novel-juncs --no-novel-indels --no-coverage-search”) in conjunction with bowtie2 (v.2.0.6) and the aforementioned transcript annotations.
For all samples, reads that had SAM flag 0x256 (indicating non-primary alignment) or mapping quality < 10 were removed before generating WIG files / further processing
Genome_build: hg19
Supplementary_files_format_and_content: WIG files: genomic coverage based on the alignments, taking only primary alignments with mapQ >= 10. Count data: tables generated by htseq-count, mode 'intersection-strict', taking only primary alignments with mapQ >= 10.
|
| |
|
| Submission date |
Dec 19, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Koos Rooijers |
| E-mail(s) |
k.rooijers@nki.nl
|
| Organization name |
Netherlands Cancer Institute
|
| Department |
Gene Regulation
|
| Lab |
Agami Lab
|
| Street address |
Plesmanlaan 121
|
| City |
Amsterdam |
| ZIP/Postal code |
1066CX |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE53499 |
LED, a long non-coding RNA activator of enhancer RNAs, is hypermethylated in human cancers |
|
| Relations |
| BioSample |
SAMN02469203 |
| SRA |
SRX396290 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1294967_MCF7_control_siScramble_1.htseq_count.with_metadata.tsv.gz |
1.3 Mb |
(ftp)(http) |
TSV |
| GSM1294967_MCF7_control_siScramble_1.wig.gz |
16.7 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
