NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1294983 Query DataSets for GSM1294983
Status Public on Mar 24, 2015
Title MCF7 LEDkd siLED 1
Sample type SRA
 
Source name mammary gland/breast
Organism Homo sapiens
Characteristics cell line: MCF7
Treatment protocol siLED, treated with 8μM Nutlin-3a for 16h
Growth protocol MCF-7cells were cultured in DMEM containing 10% FBS, penicillin and streptomycin at 37ºC and 5% CO2.
Extracted molecule polyA RNA
Extraction protocol RNA libraries were prepared for sequencing using standard Illumina protocols.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2000
 
Data processing (for ChIRP data) Adapter (GATCGGAAGAGCACACGTCTGAACTCCAGTCAC) sequences were clipped from 3' ends of reads (using cutadapt v1.1, parameters -O 12 -e 0.2 -m 12)
(for ChIRP data) Data was aligned to the human genome using bowtie2 (v. 2.0.6) using parameters “--seed 42 -N 1”.
(for ChIRP data) Peak detection was run using macs2 (v. 2.0.10.20130501)using parameters “ -g hs -B -p 0.1”. Peaks with a -log10(q-value) >= 5 and an enrichment >= 4 with respect to the input were kept, and peaks found in the odd and even samples were intersected. Overlapping peaks in both samples that had a position-wise Pearson correlation of abundance >= 0.2 and at least 25 reads in both samples were merged.
(for GROseq data) The first 6 nucleotides (index sequences) were clipped from reads. rRNA reads were removed from the data by alignment to a rRNA index compiled from Ensembl annotations (“rRNA”, “rRNA_pseudogene” and “Mt_rRNA”) using bowtie2 (v.2.0.6, parameters “--seed 42 --end-to-end -N1 -L20 -i C,1 -D5 -R5”) and keeping the unmapped reads.
(for GROseq data) Data was aligned to the human genome using bowtie2 (v. 2.0.6) using parameters “--seed 42 --sensitive”.
A transcript annotation was assembled by merging annotations from Ensembl (v. 37.65), RefSeq (obtained from UCSC Tables 9AUG2012) and the Broad lincRNA catalog (doi:10.1101/gad.17446611), using gffread (supplied with cufflinks) parameters (-M -L -F -G -T).
(for samples “MCF7 control siScramble 1”, “MCF7 control siScramble 2”, “MCF7 nutlin siScramble 1”, “MCF7 nutlin siScramble 2”, “MCF7 control totalRNA”, “MCF7 nutlin totalRNA”) Data was aligned using TopHat (v.2.0.3, parameters “-m1 -F0.0 --segment-length 21 --segment-mismatches 1”) in conjunction with bowtie2 (v.2.0.0-beta6) and the aforementioned transcript annotations.
(for all other RNAseq samples) Data was aligned using TopHat (v.2.0.7, parameters “-m1 -F0.0 --segment-length 25 --segment-mismatches 1 --no-novel-juncs --no-novel-indels --no-coverage-search”) in conjunction with bowtie2 (v.2.0.6) and the aforementioned transcript annotations.
For all samples, reads that had SAM flag 0x256 (indicating non-primary alignment) or mapping quality < 10 were removed before generating WIG files / further processing
Genome_build: hg19
Supplementary_files_format_and_content: WIG files: genomic coverage based on the alignments, taking only primary alignments with mapQ >= 10. Count data: tables generated by htseq-count, mode 'intersection-strict', taking only primary alignments with mapQ >= 10.
 
Submission date Dec 19, 2013
Last update date May 15, 2019
Contact name Koos Rooijers
E-mail(s) k.rooijers@nki.nl
Organization name Netherlands Cancer Institute
Department Gene Regulation
Lab Agami Lab
Street address Plesmanlaan 121
City Amsterdam
ZIP/Postal code 1066CX
Country Netherlands
 
Platform ID GPL11154
Series (1)
GSE53499 LED, a long non-coding RNA activator of enhancer RNAs, is hypermethylated in human cancers
Relations
BioSample SAMN02469195
SRA SRX396297

Supplementary file Size Download File type/resource
GSM1294983_MCF7_LEDkd_siLED_1.htseq_count.with_metadata.tsv.gz 1.3 Mb (ftp)(http) TSV
GSM1294983_MCF7_LEDkd_siLED_1.wig.gz 29.7 Mb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap