background strain: C57BL/6 genotype: Eµ-Myc Tg male founders (B6.Cg-Tg[IgHMyc]22Bri/J, hemizygous for Tg[IhHMyc]22Br, JAXEAST:AX12)
Treatment protocol
Eµ-Myc Tg male founders (B6.Cg-Tg[IgHMyc]22Bri/J, hemizygous for Tg[IhHMyc]22Br, JAXEAST:AX12) were obtained from the Jackson Laboratory ( Bar Harbor, Maine). These mice were bred to wildtype female C57BL/6J mice to establish a colony of Eµ-Myc transgenic mice. For genotyping of Myc-transgenic mice, DNA was extracted from approximately 3 mm tail snips using Qiagen DNEasy blood and tissue kit following manufactures instructions. DNA was then screened for the Myc transgene via TaqMan® qPCR via the relative Ct method multiplexed with the following oligos: Transgenic target primers/probe include a forward primer ATGTGCGCGGAACCCCTATT, reverse primer GGGCGACACGGAAATGTTG, probe 6Fam- ACATTCAAATATGTATCCGCTCATGAGACA-NFQ and were quantified next to endogenous reference primers/probe including a forward primer GTCATCAAGTGAGAAAGACATCCT, reverse primer CATCATGAATTTTGATAAGCCCATT, a TaqMan probe CTCCTGGCTGCCTGGCTGGC with a 5’ VIC label (4,7,2′-trichloro-7′-phenyl-6-carboxyfluorescein) as fluorescence reporter and a 3’ TAMRA label (6-carboxytetramethylrhodamine) as quencher. Briefly, 2 µL of each DNA sample was tested in a total reaction volume of 10 µL utilizing Qiagen QuantiTect PCR kit with ROX chemistry. 384 plates were processed on an AB7900HT with the following cycles: 95°C for 15 min and then 40 cycles of 95°C for 30 s, 60°C for 1 min. Each DNA sample ΔCt was compared against the ΔCt of a transgenic mutant animal as well as a transgenic negative (wildtype) DNA sample using AB RQ Manager 1.2.1 software. Likewise, commercial BCR-ABL Tg [B6.Cg-Tg(BCR/ABL)623Hkp/J] mice were also obtained from the Jackson Laboratory. The BCR-ABL Tg mice contain the truncated murine metallothionein-1 promoter driving the expression of the 190-kDa BCR-ABL fusion protein characteristic of the t(9;22) BPL. These mice were bred to wildtype female C57BL/6J mice to establish a colony of BCR-ABL transgenic mice. Pups were screened for the presence of the BCR-ABL transgene by PCR analysis of tail DNA with a BCR-ABL Tg forward primer AGAGATCAAACACCCTAACCT and a BCR-ABL Tg reverse primer CCAAAGCCATACTCCAAATGC for an expected BCR-ABL- Tg amplicon of 417-bp. Both transgenic mouse lines develop fatal BPL.
Growth protocol
Pronuclear microinjection of the human CD22DE12 transgene, founder generation, genotyping analysis of tail DNA, were performed under a service contract at the UC Davis Mouse Biology Program using standard methods. The 5.3-kb [promoter – CD22E12 cDNA - poly A] fragment of the pEµ-SR-CD22E12 transgene construct was microinjected into the pronuclei of freshly fertilized oocytes from C57BL/6J mice. Injected oocytes were transferred to day 0.5 postcoitus (dpc) pseudopregnant CD-1/Crl females to generate CD22ΔE12-Tg mice. Founders were mated to C57BL/6 J mice obtained from Jackson Laboratories; CD-1/Crl mice were obtained from Charles River laboratories. All mouse procedures were carried out in accordance with the Institutional Animal Care and Use Committee at the University of California, Davis (IACUC #15723). Tg founder mice were identified by PCR analysis of genomic tail DNA. Tg male mice were crossed to age-matched wildtype female C57BL/6 mice to produce transgenic lines and pups were screened for the presence of the transgene by PCR analysis of tail-extracted DNA. DNA was extracted from approximately 3 mm tail snips using Qiagen DNEasy blood and tissue kit according to manufacturer’s protocol.
Extracted molecule
total RNA
Extraction protocol
Total cellular RNA was extracted from homogenized lysate samples of leukemia cells using the Qiagen RNeasy Plus Mini Kit (Cat No 74134) (Qiagen, Santa Clarita, CA). In order to minimize the genomic DNA contamination in the RNA samples, the homogenized lysate samples were first run through a DNA binding spin column prior to steps of RNA binding, washing and elution. Total RNA (45L/ sample) was obtained with a concentration range of 60-200ng/L and an absorbance ratio (A260/A280) ranging from 1.9-2.1. RNA quality as judged by the integrity of the 28S and 18S ribosomal RNA was determined by an Agilent 2100 Bioanalyzer to ensure it was acceptable for subsequent microarray analysis.
Label
biotin
Label protocol
WholeTranscript (WT) Sense Target Labeling andControl Reagents,
Hybridization protocol
Following fragmentation, 45 ug of cRNA were hybridized on Mouse Gene 1.0 ST Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.
Scan protocol
GeneChip Scanner 3000 7G.
Data processing
PM signal values for probesets were extracted utilizing raw CEL files matched with probe identifiers obtained from a CDF file supplied by Mark Robinson on 2008-08-28 (MoGene-1_0-st-v1,r3.cdf) implemented by Aroma Affymetrix statistical packages ran in R-studio environment (Version 0.97.551, R-studio Inc., running with R 3.01). The PM signals were quantified using Robust Multiarray Analysis in a 3 step process including RMA background correction, quantile normalization, and summarization by a log additive model of probes in a probeset across these samples (RmaPlm method adapted in Aroma Affymetrix). All expression values were log2 scaled.
