Eµ-Myc Tg male founders (B6.Cg-Tg[IgHMyc]22Bri/J, hemizygous for Tg[IhHMyc]22Br, JAXEAST:AX12) were obtained from the Jackson Laboratory ( Bar Harbor, Maine). These mice were bred to wildtype female C57BL/6J mice to establish a colony of Eµ-Myc transgenic mice. For genotyping of Myc-transgenic mice, DNA was extracted from approximately 3 mm tail snips using Qiagen DNEasy blood and tissue kit following manufactures instructions. DNA was then screened for the Myc transgene via TaqMan® qPCR via the relative Ct method multiplexed with the following oligos: Transgenic target primers/probe include a forward primer ATGTGCGCGGAACCCCTATT, reverse primer GGGCGACACGGAAATGTTG, probe 6Fam- ACATTCAAATATGTATCCGCTCATGAGACA-NFQ and were quantified next to endogenous reference primers/probe including a forward primer GTCATCAAGTGAGAAAGACATCCT, reverse primer CATCATGAATTTTGATAAGCCCATT, a TaqMan probe CTCCTGGCTGCCTGGCTGGC with a 5’ VIC label (4,7,2′-trichloro-7′-phenyl-6-carboxyfluorescein) as fluorescence reporter and a 3’ TAMRA label (6-carboxytetramethylrhodamine) as quencher. Briefly, 2 µL of each DNA sample was tested in a total reaction volume of 10 µL utilizing Qiagen QuantiTect PCR kit with ROX chemistry. 384 plates were processed on an AB7900HT with the following cycles: 95°C for 15 min and then 40 cycles of 95°C for 30 s, 60°C for 1 min. Each DNA sample ΔCt was compared against the ΔCt of a transgenic mutant animal as well as a transgenic negative (wildtype) DNA sample using AB RQ Manager 1.2.1 software. Likewise, commercial BCR-ABL Tg [B6.Cg-Tg(BCR/ABL)623Hkp/J] mice were also obtained from the Jackson Laboratory. The BCR-ABL Tg mice contain the truncated murine metallothionein-1 promoter driving the expression of the 190-kDa BCR-ABL fusion protein characteristic of the t(9;22) BPL. These mice were bred to wildtype female C57BL/6J mice to establish a colony of BCR-ABL transgenic mice. Pups were screened for the presence of the BCR-ABL transgene by PCR analysis of tail DNA with a BCR-ABL Tg forward primer AGAGATCAAACACCCTAACCT and a BCR-ABL Tg reverse primer CCAAAGCCATACTCCAAATGC for an expected BCR-ABL- Tg amplicon of 417-bp. Both transgenic mouse lines develop fatal BPL.
Growth protocol
Pronuclear microinjection of the human CD22DE12 transgene, founder generation, genotyping analysis of tail DNA, were performed under a service contract at the UC Davis Mouse Biology Program using standard methods. The 5.3-kb [promoter – CD22E12 cDNA - poly A] fragment of the pEµ-SR-CD22E12 transgene construct was microinjected into the pronuclei of freshly fertilized oocytes from C57BL/6J mice. Injected oocytes were transferred to day 0.5 postcoitus (dpc) pseudopregnant CD-1/Crl females to generate CD22ΔE12-Tg mice. Founders were mated to C57BL/6 J mice obtained from Jackson Laboratories; CD-1/Crl mice were obtained from Charles River laboratories. All mouse procedures were carried out in accordance with the Institutional Animal Care and Use Committee at the University of California, Davis (IACUC #15723). Tg founder mice were identified by PCR analysis of genomic tail DNA. Tg male mice were crossed to age-matched wildtype female C57BL/6 mice to produce transgenic lines and pups were screened for the presence of the transgene by PCR analysis of tail-extracted DNA. DNA was extracted from approximately 3 mm tail snips using Qiagen DNEasy blood and tissue kit according to manufacturer’s protocol.
Extracted molecule
protein
Extraction protocol
Cells were washed with ice cold 1X PBS. On addition of Lysis Beads and Extraction Buffer, the sample underwent 2 rounds of rigorous mixing and vortexing for 30 seconds following incubation on ice for 10 minutes. Following centrifugation of the mixture at 10,000 x g for 20 minutes at 4°C the supernatant was transferred to a clean tube. Spin columns were used to change the buffer in the supernatant to Labeling Buffer.
Label
biotin
Label protocol
In brief, the cell lysates were biotinylated for two hours at room temperature using the Biotin reagent in the antibody array assay kit (Full Moon BioSystems, Inc.). The array slide was blocked with blocking solution for 30 min at room temperature on an orbital shaker and then rinsed ten times with Milli-Q grade water.
Hybridization protocol
The biotinylated proteins (~80 µg) were mixed with 6 ml of coupling solution (Full Moon Biosystems, Inc.) and then added over the array slide for a 2 hour incubation at room temperature while shaking. The array was then washed with 30 ml of 1x Wash Solution (Full Moon Biosystems, Inc.) for 10 minutes for a total of three times and then rinsed ten times with Milli-Q water before detection of bound biotinylated proteins using Cy3-conjugated streptavidin.. Subsequently, the array slide was incubated in Cy3-Streptavidin solution for 30 minutes in the dark while shaking. Next, the slide was washed with 1X Wash buffer and rinsed with Milli-Q water as before. The slide was then dried with compressed nitrogen and scanned using Axon GenePix 4000 scanner and the images were analyzed with GenePix Pro 6.0 (Molecular Devices, Sunnyvale, CA).
Scan protocol
Axon GenePix 4000 scanner
Data processing
The fluorescence signal of each antibody was obtained from the fluorescence intensity of this antibody spot after subtraction of the blank signal (spot in the absence of antibody). Two technical replicates were performed for each sample. Median signal intensity for each spot was extracted from array images and the average intensity for each antibody reaction with the protein was determined for replicate spots. Data were normalized utilizing the median intensity values for the 1318 antibodies on each array (Normalized data = Average Signal Intensity of Replicate Spots / Median Signal).
