NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM154487 Query DataSets for GSM154487
Status Public on Dec 01, 2008
Title PET counts from adult gut/internal organs
Sample type RNA
 
Source name Adult Gut/Internal Organs
Organism Danio rerio
Characteristics Strain: Tubingen
Organ/Tissue: Adult Gut/Internal Organs
Stage: 3-4 months old adult fish
Sex: Males & Females Mixed
Extracted molecule total RNA
Extraction protocol See Nature Method 2005 2(2):105-111.
Label not applicable
Label protocol not applicable
 
Hybridization protocol not applicable
Scan protocol not applicable
Description Paired End DiTags (PET) library, DDR001_454S_350764U_31072006_nr2_v1.
Data processing Tag counts
 
Submission date Jan 09, 2007
Last update date Jul 07, 2008
Contact name Chia Lin Wei
Organization name Genome Institute Of Singapore
Street address 60 Biopolis Street, #02-01, Genome
City Singapore
ZIP/Postal code 138672
Country Singapore
 
Platform ID GPL4737
Series (1)
GSE6694 Zebrafish Paired End DiTag libraries

Data table header descriptions
ID_REF PET sequence
VALUE PET count
UniqueID PET unique id

Data table
ID_REF VALUE UniqueID
GACATCCCAGTCCAAAATATAAATGGTAAAACAAT 2 6.1
TAAAGACACTGGCAAGGCTAAAATTGGAAGTTTTG 3 10.1
GTCAGATCTTCATCTGGCAGAAACTCGAGTAAAG 2 11.1
GAAACGCACTGTCTGCATCTATTATTTGAGTCAAAAAT 1 13.1
AGTGAGCCAAGATGGCGGCGAGAAACTGGGGAGA 1 21.1
GACTGTCAGGATCACACGGCCCTTTTGTGAATGGGTCATT 1 24.1
GACACGACACCTAACACAATGAACAGCAATCACTGGTTTC 1 25.1
GAGTCATTTCAACGGAGTAAAGATTACAAAAAGC 2 27.1
GCCTTTCCTGTTTCGGCCTAAAGTGTCAAAATAAAT 1 30.1
GATTCACACACACGCTGCGAGGAAGAGTTAAACCG 1 33.1
GAGAAGAAAATAATTAGGACATGTTATTATAAATG 1 34.1
AGTGGGTGTCCTGTGTGCGATTCCTTTTAAAAAGTGCTGG 1 37.1
GTGGCCAGAAATCGCTGGTAAAAAAAATATTTCT 1 38.1
GCCTTTCCGCGTCGGCCATAATAAAAAAGTAAAAT 1 41.1
GGAAGAGAAACACAACACATAACAGTGAAAGCGT 1 45.1
GGTTTTACCTGGCGCTGTGGCCCTCACCGGCCGAG 1 46.1
GGGTTCAGACTCCGGTGATATTAAACATCAAGACAG 4 47.1
GGCAGACTCAGCTGGTGCGCCTCTTGATATTGCTCTGAGA 1 48.1
TAAACACAGACTCCAGGACATTATCACAACAAAG 1 49.1
GAGTCGTCGCACATCTGTATATTTGATTTACCAAACACAG 1 51.1

Total number of rows: 145522

Table truncated, full table size 6740 Kbytes.




Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap