NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2180063 Query DataSets for GSM2180063
Status Public on Apr 20, 2017
Title brg1_rep1
Sample type RNA
 
Source name late blastula embryos, brg1 morpholino
Organism Xenopus tropicalis
Characteristics tissue: embryos
developmental stage: late blastula
morpholino: brg1
replicate: 1
Treatment protocol Radial injections were performed at the 2-4 cell stage with 30ng BRG1 morpholino (CCATTGGAGGGTCTGGGGTGGACAT) or 60ng control morpholino and cultivated until late blastula stage.
Growth protocol Xenopus tropicalis eggs were collected, in vitro fertilized, microinjected and cultivated following standard procedures. Embryos were staged according to Nieuwkoop and Faber (1967).
Extracted molecule total RNA
Extraction protocol Total RNA of 10 embryos was extracted using Trizol (Ambion) and phenol/chloroform. The RNA was precipitated with 70% isopropanol and cleaned using the RNeasy Cleanup Kit (Qiagen) including DNaseI-on-column digestion.
Label biotin
Label protocol Standard Affymetrix protocol.
 
Hybridization protocol Standard Affymetrix protocol.
Scan protocol Standard Affymetrix protocol on GeneChip Scanner 3000.
Description A2
Data processing R/Bioconductor, rma normalization, default parameters.
 
Submission date May 27, 2016
Last update date Apr 21, 2017
Contact name Tobias Straub
E-mail(s) tstraub@med.uni-muenchen.de
Organization name LMU Munich
Department Biomedical Center, Bioinformatics
Street address GroƟhadener Str. 9
City Martinsried
ZIP/Postal code 82152
Country Germany
 
Platform ID GPL10263
Series (2)
GSE82017 BRG1 Chromatin Remodeling ATPase Balances Germ Layer Patterning by Amplifying the Transcriptional Burst at Midblastula Transition [BRG1]
GSE82019 BRG1 Chromatin Remodeling ATPase Balances Germ Layer Patterning by Amplifying the Transcriptional Burst at Midblastula Transition

Data table header descriptions
ID_REF
VALUE RMA signal intensity

Data table
ID_REF VALUE
AFFX-BioB-3_at 7.99
AFFX-BioB-5_at 7.72
AFFX-BioB-M_at 8.39
AFFX-BioC-3_at 9.56
AFFX-BioC-5_at 9.13
AFFX-BioDn-3_at 11.58
AFFX-BioDn-5_at 10.5
AFFX-CreX-3_at 13.43
AFFX-CreX-5_at 13.23
AFFX-DapX-3_at 11.59
AFFX-DapX-5_at 8.52
AFFX-DapX-M_at 10.77
AFFX-LysX-3_at 9.29
AFFX-LysX-5_at 6.71
AFFX-LysX-M_at 7.96
AFFX-PheX-3_at 8.97
AFFX-PheX-5_at 6.86
AFFX-PheX-M_at 7.92
AFFX-r2-Bs-dap-3_at 12.02
AFFX-r2-Bs-dap-5_at 8.75

Total number of rows: 59021

Table truncated, full table size 1390 Kbytes.




Supplementary file Size Download File type/resource
GSM2180063_A2.CEL.gz 4.4 Mb (ftp)(http) CEL
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap