|
Status |
Public on Apr 20, 2017 |
Title |
control_rep2 |
Sample type |
RNA |
|
|
Source name |
late blastula embryos, control morpholino
|
Organism |
Xenopus tropicalis |
Characteristics |
tissue: embryos developmental stage: late blastula morpholino: control replicate: 2
|
Treatment protocol |
Radial injections were performed at the 2-4 cell stage with 30ng BRG1 morpholino (CCATTGGAGGGTCTGGGGTGGACAT) or 60ng control morpholino and cultivated until late blastula stage.
|
Growth protocol |
Xenopus tropicalis eggs were collected, in vitro fertilized, microinjected and cultivated following standard procedures. Embryos were staged according to Nieuwkoop and Faber (1967).
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA of 10 embryos was extracted using Trizol (Ambion) and phenol/chloroform. The RNA was precipitated with 70% isopropanol and cleaned using the RNeasy Cleanup Kit (Qiagen) including DNaseI-on-column digestion.
|
Label |
biotin
|
Label protocol |
Standard Affymetrix protocol.
|
|
|
Hybridization protocol |
Standard Affymetrix protocol.
|
Scan protocol |
Standard Affymetrix protocol on GeneChip Scanner 3000.
|
Description |
B1
|
Data processing |
R/Bioconductor, rma normalization, default parameters.
|
|
|
Submission date |
May 27, 2016 |
Last update date |
Apr 21, 2017 |
Contact name |
Tobias Straub |
E-mail(s) |
tstraub@med.uni-muenchen.de
|
Organization name |
LMU Munich
|
Department |
Biomedical Center, Bioinformatics
|
Street address |
Großhadener Str. 9
|
City |
Martinsried |
ZIP/Postal code |
82152 |
Country |
Germany |
|
|
Platform ID |
GPL10263 |
Series (2) |
GSE82017 |
BRG1 Chromatin Remodeling ATPase Balances Germ Layer Patterning by Amplifying the Transcriptional Burst at Midblastula Transition [BRG1] |
GSE82019 |
BRG1 Chromatin Remodeling ATPase Balances Germ Layer Patterning by Amplifying the Transcriptional Burst at Midblastula Transition |
|