 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 29, 2017 |
| Title |
ES_Dnmt1ko_rep4 |
| Sample type |
SRA |
| |
|
| Source name |
embryonic stem cell, Dnmt1 knockout
|
| Organism |
Mus musculus |
| Characteristics |
strain: Dnmt1tm1Enl, MGI:1857601, 129S4/SvJae
illumina platform: NextSeq500
read type: SE50
|
| Treatment protocol |
none
|
| Growth protocol |
grown in Knockout-DMEM, 1000 U/ml LIF, 0.1 mM 2-mercaptoethanol, 15% FBS, 1 mM MEM non-essential amino acids, 20 mM L-glutamine; weaned off mouse embryonic fibroblast feeder cells 2-24 h before lysis
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Trizol, TBE urea PAGE size selection 14-38 nt
Illumina sRNA library prep
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
RNA, 14-38 nt
sRNA
|
| Data processing |
small RNA: cutadapt (adapter sequence removal); fastx toolkit (quality filter; collapse reads to generate read counts); note: 3' tRNA-derived fragments do not align against genomic tRNAs without clipping CCA-tail (use bowtie2-2.2.6 or higher for correct random alignment of multimapping reads)
ChIP-Seq: fastx_trimmer -Q33 -f 6 -l 70; bowtie2 -N 1 -X 250 --no-discordant --no-mixed; samtools view -S -F 4 -b; pairToBed (filtering simple and satellite repeats); samtools rmdup; bedtools genomecov
modified 5' RACE: fastx_clipper -Q 33 -v -a TGGAATTCTCGGGTGCCAAGG; cutadapt -g GCTGATGGCGATGAATGAACACTGCGTTTGCTGGCTTTGATGAAA -O 30 --discard-untrimmed -m 10; fastq_quality_filter -Q33 -v -q 20 -p 90; bowtie-1.1.2 -v0 (alignment against genbank AC126548 and AC124426); samtools view -S -b -F 4; bamToBed; bedtools genomecov (for inserts > 100 bp)
Genome_build: mm9
Supplementary_files_format_and_content: small RNA: readcount.txt are collapsed reads before alignment (including 3' tRNA-derived fragments); ChIP: bedGraph are aligned paired end reads without duplicates or low complexity repeats, normalized to total reads per million (RPM); modified 5' RACE: bedGraph are cDNA clones (of 5' RNA ends) that align to AC124426 or AC126548 with 0 mismatches, are longer than 100 bp and normalized to total reads per million (RPM)
|
| |
|
| Submission date |
Jun 02, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Robert A Martienssen |
| E-mail(s) |
martiens@cshl.edu
|
| Organization name |
Cold Spring Harbor Laboratory
|
| Department |
Delbruck Bldg.
|
| Lab |
Martienssen
|
| Street address |
1 Bungtown Rd
|
| City |
Cold Spring Harbor |
| State/province |
NY |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE82199 |
LTR-retrotransposon control by tRNA-derived small RNA |
|
| Relations |
| BioSample |
SAMN05199871 |
| SRA |
SRX1817711 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2186384_readcount_ES_Dnmt1ko_rep4.txt.gz |
4.2 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
