|
| Status |
Public on Oct 25, 2017 |
| Title |
Lib2_Cones_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Cones
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Cones
mouse strain: d4-Cre x B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J # 007911
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated from sorted cells using Qiagen RNeasy® Mini Kit with on-column DNase digestion followed by reverse transcription using Takara PrimeScript RT Reagent Kit (#RR047A).
barcodes were amplified with KAPA HIFI Hotstart using Primer #1 and indexing primers (Primers #3-11)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
RNA Barcodes in Cones
processed data file: Lib2Results.tab
|
| Data processing |
Library strategy: Parallel Reporter Assay
A custom pipeline was created to assign barcodes to each tested sequences. Then sequence activity was calculated as the ratio of barcode abundance in the RNA sample compare to its abundance in the AAV pool.
Barcode sequences were extracted from 50bp reads by taking only reads starting with the expected backbone sequence: “TCCTGCTGGAGTTCGTGACCTGCATGCGCCGAA”. From these reads the sequence at position 34-48 was extracted. The frequency of each barcode sequence was calculated to get counts for each sample. Counts of barcodes were normalized to library size. Enrichment of barcodes in the RNA sample was calculated over their representation in the AAV input. Barcodes not sufficiently covered in the AAV sequencing were discarded (depending on sequencing depth 2-16 reads). The median activity of all barcodes per CRE was calculated. Only CREs that were covered in at least 2 out of 3 biological replicates with at least three barcodes were used for downstream analysis.
processed data: Tab delimited, summary table of the expression values for each tested seqeunce in the tested cell types
Genome_build: mm9
|
| |
|
| Submission date |
Jul 19, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Dirk Schuebeler |
| Organization name |
Friedrich Miescher Institute for Biomedical Research
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE84589 |
Cis-regulatory landscape of four cell types of the retina |
|
| Relations |
| BioSample |
SAMN05417354 |
| SRA |
SRX1960886 |
