NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2304405 Query DataSets for GSM2304405
Status Public on Jan 01, 2017
Title Rpo21_0_replicate2
Sample type SRA
 
Source name Rpo21 0
Organism Saccharomyces cerevisiae
Characteristics sample type: crosslinked RNA
Growth protocol Yeast cells were grown in SD -TRP media containing 2% glucose overnight and inoculated into fresh media at a starting OD600 of 0.05. Cells were grown for about 7 hours (until OD600=0.5) and either UV crosslinked (0 timepoint) or filtered and transferred to SD -TRP containing 2% glycerol and ethanol instead of glucose. Cells were UV crosslinked 4 or 8 minutes later.
Extracted molecule total RNA
Extraction protocol Cells were lysed, followed by stringent, denaturing, two-step affinity purification of the tagged protein. Bound RNA was partially degraded with RNase, radiolabeled, and 5’ and 3’ linkers were added. Finally, covalent RNA-protein complexes were isolated by SDS-PAGE. Following Proteinase K digestion of the bound proteins, RNA fragments were amplified by RT-PCR.
RNA libraries were prepared using the standard CRAC protocol (Tuck and Tollervey, 2013)
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Description Barcode: NNNATTAGC
Data processing Data was preprocessed using the fastx package. All sequences are of the form:
5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNXXXXXX==INSERT==TGGAATTCTCGGGTGCCAAGGCCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG-3’
where NNN are random nucleotides to assess for duplicates in PCR amplification and XXXXXX is a barcode to allow for multiplexing of different libraries. The barcode used for each sample is listed in the 'description' field.
Fastq files were split by barcode using pyBarcodeFilter.py in the pyCRAC package (Webb, et al, 2014). -m 0
Reads were aligned to the genome using Novoalign. -r Random
Reads were counted using pyReadCounter. --sense
Sequences were plotted along the genome using pyGTF2bedgraph
Genome_build: EF4.68
Supplementary_files_format_and_content: bedgraph or bigwig files showing the distribution of reads across the yeast genome
 
Submission date Sep 06, 2016
Last update date May 15, 2019
Contact name Stefan Bresson
E-mail(s) stefan.bresson@gmail.com
Organization name University of Edinburgh
Department Wellcome Trust Centre for Cell Biology
Lab Tollervey Lab
Street address Max Born Crescent, Swann 5.1
City Edinburgh
State/province Scotland
ZIP/Postal code EH9 3BF
Country United Kingdom
 
Platform ID GPL13821
Series (1)
GSE86483 Nuclear RNA decay pathways aid rapid remodeling of gene expression in yeast
Relations
BioSample SAMN05732397
SRA SRX2141147

Supplementary file Size Download File type/resource
GSM2304405_Rpo21_0_replicate2_minus_strand.bedgraph.gz 597.1 Kb (ftp)(http) BEDGRAPH
GSM2304405_Rpo21_0_replicate2_plus_strand.bedgraph.gz 580.3 Kb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap