NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM255773 Query DataSets for GSM255773
Status Public on Feb 08, 2008
Title Day 2 Present Day
Sample type SRA
 
Source name Day 2 Present Day
Organism marine metagenome
Characteristics air, phytoplankton bloom, bacterial population.
Treatment protocol Waters samples were prefiltered through a 1.6 um GF/A glass fibre filter to reduce Eukaryotic contamination. Filtrate was then collected on a 0.2 um Sterivex (millipore) filter which was frozen in liquid nitrogen until nucelic acid extraction.
Growth protocol Air bubbled through 11,000 L mesocosm. Then phosphate and nitrate were added to induce a phytoplankton bloom.
Extracted molecule total RNA
Extraction protocol Total nucleic acid extraction was done as quickly as possible using the method of Neufeld et al. 2007. For transcriptomics, total RNA was separated from the columns using the RNA MinEluteTM clean-up kit (Qiagen) and checked for integrity of rRNA using an Agilent bioanalyser (RNA nano6000 chip). High integrity rRNA is essential for subtractive hybridization. Samples were treated with Turbo DNA-free enzyme (Ambion) to remove contaminating DNA. The rRNA was removed from mRNA by subtractive hybridization (Microbe Express Kit, Ambion), and absence of rRNA and DNA contamination was confirmed using the Agilent bioanalyser. The mRNA was further purified with the MEGAclearTM kit (Ambion). Reverse transcription of mRNA was performed using the SuperScript® III enzyme (Invitrogen) with random hexamer primers (Promega). The cDNA was treated with RiboShredderTM RNase Blend (Epicentre) to remove trace RNA contaminants. To improve the yield of cDNA, samples were subjected to random amplification using the GenomiPhi V2 method (GE Healthcare). GenomiPhi technology produces branched DNA molecules that are recalcitrant to the pyrosequencing methodology. Therefore amplified samples were treated with S1 nuclease using the method of Zhang et al.2006. DNA and mRNA were sequenced using the 454 Corporation GS-FLX instrument at the NERC-funded University of Liverpool 454 Sequencing Facility. Extraneous sequences that resulted from > 1 template molecule per picotitre well were removed from the datasets.
 
 
Description Raw data for both the metagenomic and metatranscriptomic components are available at NCBI's Short Read Archive under accession SRP000101
Data processing Sequences were read and raw counts reported.

Raw sequence data files for this record are available for download from the SRA FTP site under accession SRX000134
 
Submission date Jan 09, 2008
Last update date May 15, 2019
Contact name Jack Anthony Gilbert
E-mail(s) jagi@pml.ac.uk
Phone 01752 633 416
Fax 01752 633 101
URL http://www.pml.ac.uk
Organization name Plymouth Marine Laboratory
Street address Prospect Place
City Plymouth
State/province Devon
ZIP/Postal code PL1 3DH
Country United Kingdom
 
Platform ID GPL26673
Series (1)
GSE10119 Metatranscriptomes of phytoplankton blooms from an ocean acidification mesocosm experiment

Data table header descriptions
ID_REF short reads
VALUE number of observations

Data table
ID_REF VALUE
AAAAAAAAAATGTCCCCTCGGAGAAATTTTCGCGGGAAAATTCAATTTTTTTTTGAGTCGCTTATGATATCATATGAAAAAGTTCCAATTAAAGGTGCAGCTAGTATTACCTGCACCTAATTGGGAACCTGGAACACTTTTTATTTTCTCCTCTCTCTCACACCCTCATCATGGCCAATGCAAAGAACTGGTGTTTCACCATCAACAACCCGCATCCTTATGACGCAGATGTCATCAAGGCATGGCATCCGGACCTTGCCCAATACGTCGT 1
AAAAAAAAAATTGAATTTTTCCCCGCGAAAATTTCTCCGAGGGGACAATTTTTTTTGAATTCGTGTGGGCAGTTCGCTGTTGGCCGATGCCGGCTCATGCGTGAGGCTGCGCCCTCACAGCCTACGTGT 1
AAAAAAAAAGACGGGGTGGCGTGAGCCACCCCAAGACAACAATAGTTTCTATTCAATAGTCACCTTGCTGCAATTGGAAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCGGTTGCTACACGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGC 1
AAAAAAAAAGACGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAAGAAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGGTTGCTACACGGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGCATGAGCCGGCATCGGCCAACAGCGAACTGCCCACACGAATTCAAAAAAAAATGTCCCCT 1
AAAAAAAAAGACGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCGGTTGCTACACGGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGCATGAGCCGGCATCGGCCAACAGCGAACTGCCCACACGAATTCAAAAAAAATGTCCCCTCGGAGAAATTTTCGC 1
AAAAAAAAAGCGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCGGTTGCTACACGGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGCATGAGCCGGCATCGGCCAACAGCGAACTGCCCACACGAATTCAAAAAAAAATGTCCCCTCGGAGAAATTTTTCGCGGGAAAATTCAAATTTTTTTGAGTCGCTTATGATATCATATAAAAAAGTTA 1
AAAAAAAAAGCGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGGTTGCTACACGGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGCATGAGCCGGCATCGGCCAACAGCGAACTGCCCACACGAATTCAAAAAAAAAATGTCCCCTCGGAGAAATTTTTCGCGGGAAAATTCAAATTTTTTTGAGTCGCTTATGATATCATAT 1
AAAAAAAAAGCGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGGTTGCTACACGGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGCATGAGCCGGCATCGGCCAACAGCGAACTGCCCACACGAATTCAAAAAAAAATGTCCCCCCGGAGAAATTTTTCGCGGGAAAATTCAAATTTTTTTGTGTCGCTTATGATATCATAAGAAAA 1
AAAAAAAAAGCGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCGGTTGCTACACGGGATAGGAAACGAACTGCCCACACGTAGGCTGTGAGGGCGCAGCCCTCACGCATGAGCCGGCATCGGCCAACAGCGAACTGCCCACACGAATTCAAAAAAAAATGTCCCCTCGGAGAAATTTTTCGCGGGAAATTCAAATTTTTTGAGTCGCTTATGATATCATATAAAAAAGTTA 1
AAAAAAAAAGCGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTTGCTGCACTTGGAAGAAAATAAAAAATGACTCCTCGGAAAAATATTTCTATGATATCTTGACTCAAGCCTATAGGTATAGTATTACCCTATAGGCCTGTGAGTCGAGTCACATATGATACCTATGATATCATAGCTCGACACACCATTTTTTTATGATATTAGCCAATGATATCATACCCCTCTACCCTAACCCTAACCCTAA 1
AAAAAAAAATAGTCCCCTCGGAGAAATTTTTCGCGGGAAAATTCAAATTTTTTTGAGTCGCTTATGATATCATATGAAAAAGTTCCAATTAAAGGTGCAGCTAGTATTACCTGCACCTAATTGGGAACCTGGAACACTTTTTATTTTCTCCTCTCTCTCACACCCTCATCATGGCCAATGCAAAGAACTGGTGTTTCACCATCAACAACCCGCATCCTTATGACGCAGATGTCATC 1
AAAAAAAAATGCTTATTTTGTTTTTTTAACTTCATTGGCACAAATATCAAATTCAACCATGACACCATTATCAATTAATTTTTTAATACCTCTTCCTGAAACTAATGGATTTGGATCCTTGGAACCAATGACAACTTTTTTTATCCAGCTTTAATGATTGCATCTGAGCATGGACCAGTTTTACCATGATGACTACATGGCT 1
AAAAAAAAATGTCCCCCCGGAGAAATTTTTCGCGGGAAAATTCAAATTTTTTTGTGTCGCTTATGATATCATAAGAAAATGATCCACAATCCCAAGTCAGTATTACCTTGGGATAATGTGGATCACTAGATCACATTTATTTTTTCTCTCTCTCCCACACCCTCATCATGACTCTAGCAAAGAACTGGTGCTTCACCATCAACAACCCGCATCCTTACGACGAAGATGTCATCAAGGCGTGGCATCCGGACCTCGCCACCTACCTCGT 1
AAAAAAAAATGTCCCCTCGGAGAAATTTTCGCGGGAAAATTCAATTTTTTTTGAGTCGCTTATGATATCATATGAAAAAGTTCCAATTAAAGGTGCAGCTAGTATTACCTGCACCTAATTGGGAACCTGGAACACTTTTTATTTTCTCCTCTCTCTCACACCCTCATCATGGCCAATGCAAAGAACTGGTGTTTCACCATCAACAACCCGCATCCTTATGACGCAGATGTCATCAAGGCATGGCATCCGGACCTTGCCCAATACGTCGT 1
AAAAAAAAATGTCCCCTCGGAGAAATTTTCGCGGGAAAATTCAATTTTTTTTGAGTCGCTTATGATATCATATGAAAAAGTTCCAATTAAAGGTGCAGCTAGTATTACCTGCACCTAATTGGGAACCTGGAACACTTTTTATTTTCTCCTCTCTCTCACACCCTCATCATGGCCAATGCAAAGAACTGGTGTTTCACCATCAACAACCCGCATCCTTATGACGCAGATGTCATCAAGGCATGGCATCCGGACCTTGCCCAATCGTCGT 1
AAAAAAAAATGTCCCCTCGGAGAAATTTTCGCGGGAAAATTCAATTTTTTTTGAGTCGCTTATGATATCATATGAAAAAGTTCCAATTAAAGGTGCAGCTAGTATTACCTGCACCTAATTGGGAACCTGGAACACTTTTTATTTTCTCCTCTCTCTCACACCCTCATCATGGCCAATGCAAAGACTGGTGTTTCACCATCAAC 1
AAAAAAAAATGTCCCCTCGGAGAAATTTTCGCGGGAAAATTCAATTTTTTTTTGTAGTCGCTTATGATATCATATGAAAAAGTTCCAATTAAAGGTGCAGCTAGTATTACCTGCACCTAATTGGGAACCTGGAACACTTTTTATTTTCTCCTCTCTCTCACACCCTCATCATGGCCAATG 1
AAAAAAAACGCGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTTGCTGCACTTGGAAGAAAATAAAAAACTGACTCCTCGGAAAAATATTTCTATGATATCTTGACTCAAGCCTATAGGTATAGTATTACCCTATAGGCCTGTGAGTCGAGTCACATATGATACCTATGATATCATAGCTCGACACACCTATTTTTTTAATGATATTAGCCAATGATATCACTACCCCT 1
AAAAAAAAGACGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCAACTATTTCAACTGTAACAAGATGTTCCCGCAATCGGCAGCAAGCAAGGACGACCTGCAAGCGTACATGAATGCGAACCCGACGGAAAGGGCGCTATTCAAGATTTGGACGACATGCGTGGACAACACGGAAAACCCGTATGCAGTCCAGGTCCTTCTCACGATCAAGTACAAAGTCAAGATGTGGCAACTTAAGGATCTCGGACCG 1
AAAAAAAAGACGGGGTGGCGTGAGCCACCCCAAGACACAATAGTTTCTATTCAATAGTCACCTATTGGAGAAACCCCTCTACCCTAACCCTAACCCTAACCCTAACCCT 1

Total number of rows: 99488

Table truncated, full table size 22317 Kbytes.




Supplementary data files not provided
Raw data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap