|
| Status |
Public on Oct 12, 2017 |
| Title |
Active-TBPT-rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Melanocyte stem cells
|
| Organism |
Mus musculus |
| Characteristics |
protocol: Active
tissue: Skin
age: Postnatal 10 weeks
genotype: TBPT
|
| Treatment protocol |
Chemical Depilation or UVB irradiation
|
| Growth protocol |
Mice were raised under standard conditions
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were sorted through FACS, and total RNA was isolated using Trizol LS reagent
RNA-seq libraries were prepared from 500 ng total RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
gene_exp.diff: A_1
genes.read_group_tracking: A_1
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--no-novel-juncs) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC).
cuffquant (--no-novel-juncs) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC).
Genome_build: Mouse mm10 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
|
| |
|
| Submission date |
Aug 13, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE102597 |
Melanocyte Stem Cell Activation and Translocation Initiate Cutaneous Melanoma in Response to Ultraviolet Exposure |
|
| Relations |
| BioSample |
SAMN07502179 |
| SRA |
SRX3090845 |
