|
Status |
Public on Oct 12, 2017 |
Title |
Active-TBPT-rep2 |
Sample type |
SRA |
|
|
Source name |
Melanocyte stem cells
|
Organism |
Mus musculus |
Characteristics |
protocol: Active tissue: Skin age: Postnatal 10 weeks genotype: TBPT
|
Treatment protocol |
Chemical Depilation or UVB irradiation
|
Growth protocol |
Mice were raised under standard conditions
|
Extracted molecule |
total RNA |
Extraction protocol |
Cells were sorted through FACS, and total RNA was isolated using Trizol LS reagent RNA-seq libraries were prepared from 500 ng total RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
gene_exp.diff: A_1 genes.read_group_tracking: A_1
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.0.13 (--no-novel-juncs) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC). cuffquant (--no-novel-juncs) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC). cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC). Genome_build: Mouse mm10 (UCSC) Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
|
|
|
Submission date |
Aug 13, 2017 |
Last update date |
May 15, 2019 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL19057 |
Series (1) |
GSE102597 |
Melanocyte Stem Cell Activation and Translocation Initiate Cutaneous Melanoma in Response to Ultraviolet Exposure |
|
Relations |
BioSample |
SAMN07502179 |
SRA |
SRX3090845 |