 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 21, 2018 |
| Title |
B05_r1 |
| Sample type |
SRA |
| |
|
| Source name |
macrophage
|
| Organism |
Mus musculus |
| Characteristics |
time point: 5
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Macrophages were isolated from inert conduits 5, 14 and 28 days after sciatic transection by flow cytometry (Lin-F4/80+CD14+CD11b+CD16/32+). Total RNA was isolated with the Quick-RNA MicroPrep kit (Zymo Research).
RNA-seq libraries were prepared from 25 ng total RNA using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
response to nerve repair
B05_0
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--no-novel-juncs) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC).
cuffquant (--no-novel-juncs) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC).
Genome_build: Mouse mm10 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
|
| |
|
| Submission date |
Nov 03, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE106488 |
Temporal Changes in Macrophage Phenotype after Peripheral Nerve Injury |
|
| Relations |
| BioSample |
SAMN07974968 |
| SRA |
SRX3359240 |
| Supplementary data files not provided |
SRA Run Selector |
| Processed data are available on Series record |
| Raw data are available in SRA |
|
|
|
|
 |
