NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM286607 Query DataSets for GSM286607
Status Public on Jun 02, 2008
Title 6-10hr embryo
Sample type SRA
 
Source name Drosophila melanogaster 6-10hr embryo
Organism Drosophila melanogaster
Characteristics Drosophila melanogaster 6-10hr embryo
Extracted molecule total RNA
Extraction protocol total RNA from 6-10hr embryo, ~18-26nt RNAs isolated using PAGE, ligation to adapters requires 5' monophosphate and 3' OH
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina Genome Analyzer
 
Description small RNAs
Data processing raw sequences were clipped by 3' linker sequences recognition, and select clipped sequences longer than 18 nt
 
Submission date May 05, 2008
Last update date May 15, 2019
Contact name Wei-Jen Chung
Phone 212-6395549
Organization name Sloan-Kettering Institute
Department Developmental Biology
Lab Lai
Street address 430 E 67th St
City New York
State/province NY
ZIP/Postal code 10021
Country USA
 
Platform ID GPL9058
Series (1)
GSE11624 Drosophila melanogaster small RNA sequence from 14 libraries
Relations
SRA SRX029075
BioSample SAMN00116368

Data table header descriptions
SEQUENCE small RNA sequence
COUNT number of times small RNA was sequenced

Data table
SEQUENCE COUNT
GCGTTATCACTGTCTGAAGCTT 1
TCCTCGATAGTATAGTGTTTTTTATTTTTATGTAAA 1
GGCGCCTTGACGACGTATTTGGTTG 1
CGAAGATTGCAGGTTCGCCCCCTG 1
TGCCCCCTTCAGCGGCTTTGCGC 4
CCCGCACAAGCGATCCCGGCGCCT 1
ATGGATGCGTGGGTATCCCACT 1
GCGTTGGTGGTTCAGTGGTAGTATGTTCGTCTG 1
TTCATGCAACCCACAATACAAGAG 2
CGTAGTTGAACTTGTGCTTCAT 2
GACGATAGGAGGCAAGATTGGTCTGGAGGTATC 1
CTAGCACACGCTTCTTGTCCGT 1
TACGAGTAGGATATCGATCTGGTGG 62
TAGAAATAGCCAAATCCATGTACA 8
AAGGTAGCCTGAGCAAGCACG 1
GAGGTTGCCAAGCTTCCGGATGACTT 2
GCAGTCGTGGCAGAGGATGTAGGGAGAAATAAAATA 1
TGAAACCTCGTGTCGTTACTGTC 1
AGGGATAGGTCCGCTGAGTGTCGGTAGTCACCC 1
TCTCTCTCTCTCCATCTCACTCTCT 5

Total number of rows: 618227

Table truncated, full table size 18045 Kbytes.




Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap