NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM32172 Query DataSets for GSM32172
Status Public on Oct 15, 2004
Title Comprehensive examination of bacterial diversity and community structure in a sheep rumen by improved SARST (iSARST)
Sample type SARST
 
Source name Microbiome DNA from the adhering fraction of a sheep rumen
Organism Bacteria
Extracted molecule total RNA
 
Description The RSTs were generated using an improved version of SARST (referred to as iSARST) from the microbiome DNA extracted from the adhering fraction of the rumen content taken from a sheep. The iSARST method is going to be submitted to Nature Biotechnology for publication.
Lot batch =
 
Submission date Oct 12, 2004
Last update date May 27, 2005
Contact name Zhongtang Yu
E-mail(s) yu.226@osu.edu
Phone 614-292-3057
Fax 614-292-7116
Organization name The Ohio State University
Department Animal Sciences
Lab Microbiology
Street address 2027 Coffey Rd.
City Columbus
State/province OH
ZIP/Postal code 43210
Country USA
 
Platform ID GPL919
Series (1)
GSE1842 Community composition of plant biomass-associated bacteria in sheep rumen

Data table header descriptions
TAG RST sequences (5'->3')
COUNT Frequency of each RST
RST_ID ID of ribosomal sequence tags (RSTs)

Data table
TAG COUNT RST_ID
AACGAGGCGACCTTAAGACGACTCAGTGCTTGCACAAAGTTGGAAGAAGATCATCGCCTAGTGGCAGACGGGT 1 SR-ad-1
GAGCGGGAGTATTGCAACCAGAGATTCGTCAAAGTGAGKGATATGAGAGCGGCGGACGGGT 1 SR-ad-2
CGAACGGGGTTATTTAGAAGCTTGCTTRTGGATAACTTAGTGGCGGACGGGT 2 SR-ad-3
CGAGGGGCAGCATGAGATTAGCTTGCTAATCTTGATGGCGACCGGCGCACGGGT 10 SR-ad-4
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAAGCCTAGTGGGTGAC 1 SR-ad-5
TTGACCGTGCAGCCTAATGCATGCAAGT 12 SR-ad-6
CGAACGGACATGGCACCGGAGCAGAAGAGTTCGCTTGGACGCTCCCCGTCATGTTAGTGGCGGACGGGT 1 SR-ad-7
GCGTAACACGTGGACTGCACGGTCAA 18 SR-ad-8
CGAACGGACTTTACATGAAGCCTAGCGATTGTAAAGTTAGTGGCGGACGGGT 14 SR-ad-9
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTCATTTTAAACTTAGTGGCGGACGGGT 240 SR-ad-10
CGAACGAAGCACATTCCTTCGGGGATGTGACTGAGTGGCGGAC 2 SR-ad-11
CGAGGGGCAGCATGAAGTTTGCTTGCAAACTTTGATGGCGACCGGCGCACGGGT 201 SR-ad-12
CGAGCGGGAATCTGTTGATTGAGACTTCGGTGGATTGATGCAGAGGATAGCGGCGGACGGGT 2 SR-ad-13
CGAACGGGGTTTAAGAAGGAAGCTTMCTTTCATTTTAAACYTAGMGGCGGACGGGT 1 SR-ad-14
CGAGGGGCAGCGCTGAGTAGCAATACTCTGACGGCGACCGGCGCACG 1 SR-ad-15
CGAGCGGGAGTATCGCAAACAGAGATTCGTCAAAGTGAGCGATATGAGAGCGGCGGACGGGT 4 SR-ad-16
CGAACGTGAAAGTGCCTTCGGGTGCGAGTAAAGTGGCGCACGGGT 1 SR-ad-17
GGAAGAGGGGCATCATGGAGTTTGCTTGCAAACTCTGATGGCGACCGGCGCACGGGT 6 SR-ad-18
CGAACGGAATTATGGGGCTTGCTCCATAATTTAGCGGCGCACGG 1 SR-ad-19
CGAACGGGGTTTAAGAAGGAAGCTTGCTTTTGTTTATACTTAGTGGCGGACGG 1 SR-ad-20

Total number of rows: 236

Table truncated, full table size 15 Kbytes.




Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap