NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM322208 Query DataSets for GSM322208
Status Public on Sep 30, 2008
Title small RNA from 3rd instar larvae (1)
Sample type SRA
 
Source name Drosophila melanogaster 3rd instar larvae
Organism Drosophila melanogaster
Characteristics 3rd instar larvae
Extracted molecule total RNA
Extraction protocol total RNA from 3rd instar larvae, ~18-26nt RNAs isolated using PAGE, ligation to adapters requires 5' monophosphate and 3' OH
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer
 
Description Small RNA data.
Data processing raw sequences were clipped by 3' linker sequences recognition, and select clipped sequences longer than 18 nt
 
Submission date Sep 18, 2008
Last update date May 15, 2019
Contact name Nicolas Robine
E-mail(s) robinen@mskcc.org
Organization name Memorial Sloan Kettering Cancer Center
Department Developmental Biology
Lab Eric Lai
Street address 1275 York Avenue, Box 252
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL9058
Series (1)
GSE12840 Drosophila melanogaster late embryo, larval, pupal and adult head small RNA libraries
Relations
SRA SRX002667
BioSample SAMN02195761

Data table header descriptions
SEQUENCE
COUNT number of times small RNA was sequenced

Data table
SEQUENCE COUNT
GAGCTTTTAGTGGGCCCTAGCA 1
TATTGAAGGAATTGATATAGCC 4
TGTGGGTAGGGGAATCTGTGGAC 9
CAACTTTTGATGGTAGTCGG 1
GCGTTGGTTGCTTAAACTGCAGACC 1
TTGGGTTCTGGGGGGAGCTCAAA 1
CTGCACGCACCATCAATCGTATGCCGTTT 1
TCGGAGCGTGGCGTGAATGTTT 1
GTGAGGGCTTGGTCAGCTGGGAA 1
GAAAGGGAAGGGCATTTGAACCGGTAG 1
GTTGTGTCGATATTTTCTCCTCG 1
GATGGCGGATCACCAATTAGCACA 1
AAGACCGATCCGGATGCCCTG 1
TCAGTCTTTCTCTCTCTCCTATCTTTAGTC 1
CCGGGGTTCGATTCCCCGCCGGGGAGCCA 1
TCCACCCGGAGGCGCCACTTAGG 1
AAGGGTCGGGTAGTGAGGGCCTGTCGCAG 1
CCTATCATTGTGAAGCAAAATCAGTA 1
ATAGAGCAAAAGGGCAAATGCTGA 1
GCTGAAGGTGCGGTAACATC 1

Total number of rows: 1225829

Table truncated, full table size 32576 Kbytes.




Supplementary file Size Download File type/resource
GSM322208.fa.gz 39.5 Mb (ftp)(http) FA
SRA Run SelectorHelp
Raw data are available in SRA
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap