NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3258910 Query DataSets for GSM3258910
Status Public on Dec 04, 2018
Title Aged_Daughter 4a12A
Sample type SRA
 
Source name LT-HSC sorted from aged mouse (daughter cell)
Organism Mus musculus
Characteristics strain: B6.SJL mice
tissue: Long-term Hematopoietic stem cells (LT-HSC)
Growth protocol Cells were cultured in IMDM + 10% FBS + Cytokines mSCF,GCSF, and mTPO 50ng/ml at 37°C (5% CO2, 3% O2). Mother cells were collected 16hrs after culture. Daughter cells were cultured for 40 to 44 hrs, for first cell division.
Extracted molecule genomic DNA
Extraction protocol cells were separated by pipetting and singularly subjected to fragmentation of open chromatin-regions using Tn5 transposase (Illumina), followed by a pre-amplification step, library preparation and subsequent paired-end sequencing.
For the pre-amplification step, NEBNext Ultra II Q5 Master Mix was used with Primer 1: 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’ and Primer 2: 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’. For dual-indexing, 10 μL of the pre-amplified ATAC reaction was used as input for Nextera index kit (Illumina). The generated libraries were quantified using agilent bio-analyzer and qPCR kit (New England Biolabs).
 
Library strategy ATAC-seq
Library source genomic
Library selection other
Instrument model Illumina HiSeq 3000
 
Data processing Standard Illumina software used for basecalling and demultiplexing
Adaptor trimming was performed using cutadapt 1.9.1
Sequences were aligned to the UCSC mouse reference genome mm10 using Bowtie 2
Peak calling was performed using MACS2
Genome_build: mm10
Supplementary_files_format_and_content: bed format
 
Submission date Jul 06, 2018
Last update date Dec 04, 2018
Contact name Medhanie Assmelash Mulaw
E-mail(s) medhanie.mulaw@uni-ulm.de
Organization name University of Ulm
Street address Albert-Einstein-Allee 11
City Ulm
ZIP/Postal code 89081
Country Germany
 
Platform ID GPL21493
Series (2)
GSE116707 Aging alters the epigenetic asymmetry of HSC division [scATAC-Seq]
GSE116712 Aging alters the epigenetic asymmetry of HSC division
Relations
BioSample SAMN09622564
SRA SRX4347422

Supplementary file Size Download File type/resource
GSM3258910_4a12A_peaks.bed.gz 137.6 Kb (ftp)(http) BED
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap