NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3518179 Query DataSets for GSM3518179
Status Public on Jun 01, 2020
Title liver_32m_3_ribo
Sample type SRA
 
Source name Liver
Organism Mus musculus
Characteristics strain: C57BL/6
age: 32 months
tissue: Liver
Extracted molecule total RNA
Extraction protocol N2l frozen and stored at -80°C liver and kidney samples of approximate weight of 55 mg and 75 mg respectively were taken for lysis. Tissues were lysed with the same lysis protocol as described in Gerashchenko et al., 2018, bioRxiv. After homogenization and centrifugation 250 µl of lysate were supplied with 20 Units of SUPERase-In RNAse inhibitor and taken for RNA-Seq library preparation, the 500 µl of lysate were brought to 1 ml with lysis buffer and taken for ribosome profiling library preparation.
Ribosome profiling libraries were prepared as described in doi:10.1101/279257 with modification in RNase digestion indicated below. RNA digestion of lysates was performed for 1 hour with mixture of RNase T1 (2000 Units) and RNase S7 (300 Units). After 30 minutes of incubation 0.8 mg of heparin were added to inhibit all RNases except for RNase T1. After digestion lysates were supplied with 80 Units of SUPERase-In RNAse inhibitor. For RNA-Seq total RNA was isolated from 250 µl of lysate with 750 µl of TRIzol LS Reagent and treated with RQ1 RNase-Free DNase (1 Unit for 1 µg of total RNA) for 30 minutes at 37°C with subsequent water saturated acidic phenol extraction and precipitation by the ethanol method (with addition of 1/100 volume of glycogen RNA grade). 500 ng of DNase treated total RNA was depleted of ribosomal RNA with NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (#E6310) and used for transcriptome libraries preparation with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (#E7760).
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina NextSeq 500
 
Description Ribosome-bound RNA
Data processing Library strategy: Ribosome profiling
For the Ribo-Seq data: adapter sequences were cut with cutadapt v1.14 (-a AGATCGGAAGAGCACACGTCT)
For the Ribo-Seq data: the remaining low-quality base calls at the read ends were additionally removed with sickle v1.33.
RNA-Seq data: no special trimming was applied
Read mapping and counting was performed with STAR v2.5.3.
Genome_build: mm10
Supplementary_files_format_and_content: Tab-separated text files containing read counts per gene as estimated by STAR.
 
Submission date Dec 17, 2018
Last update date Jun 01, 2020
Contact name Aleksandra S Anisimova
E-mail(s) aleksandra.anisimova@univie.ac.at, alessandrick@gmail.com
Organization name Max Perutz Labs, Vienna BioCenter, University of Vienna, Medical University of Vienna
Lab Karagöz Lab
Street address Dr. Bohr Gasse 9
City Vienna
ZIP/Postal code 1030
Country Austria
 
Platform ID GPL19057
Series (1)
GSE123981 Age-resolved ribosome profiling and RNA-Seq data of mice liver and kidney samples
Relations
BioSample SAMN10604350
SRA SRX5145226

Supplementary file Size Download File type/resource
GSM3518179_liver_32m_3_ribo.tsv.gz 234.9 Kb (ftp)(http) TSV
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap