NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM360260 Query DataSets for GSM360260
Status Public on Jan 21, 2009
Title small RNA from 0-1 day old pupae
Sample type SRA
 
Source name Drosophila melanogaster 0-1 day old pupae
Organism Drosophila melanogaster
Characteristics 0-1 day old pupae
Extracted molecule total RNA
Extraction protocol total RNA from 0-1 day old pupae, ~18-26nt RNAs isolated using PAGE, ligation to adapters requires 5' monophosphate and 3' OH
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer
 
Description Small RNA data.
Data processing raw sequences were clipped by 3' linker sequences recognition, and select clipped sequences longer than 18 nt
 
Submission date Jan 14, 2009
Last update date Jun 11, 2013
Contact name Nicolas Robine
E-mail(s) robinen@mskcc.org
Organization name Memorial Sloan Kettering Cancer Center
Department Developmental Biology
Lab Eric Lai
Street address 1275 York Avenue, Box 252
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL9058
Series (1)
GSE12840 Drosophila melanogaster late embryo, larval, pupal and adult head small RNA libraries
Relations
BioSample SAMN02195579

Data table header descriptions
SEQUENCE
COUNT number of times small RNA was sequenced

Data table
SEQUENCE COUNT
ATGGCCGGTTCGGATCCTGCCGTGGGCGCCA 1
ATCTTATGGTATTGGCTGGTGGGGCCATTCAT 1
CCAATCTTCGGTTGGTGTGCTAAATC 1
AATCGCGTCACATAATAAACAAGAA 1
AGATTTTAGGATGGGCAAAGG 1
CCACTACTGCGTGTCCTGCGCA 1
GTTGTGTCGATATTTTCTCCTCG 51
GAAGCCTATCCTTTGCTTGATGATTCG 1
CGCGGGTAAACGGCGGGTGTTTGTTGGCAAAAAAA 1
GAATGATTAGAGGCCTTAGGGTCGA 1
CGTAGTTGAACTTGTGCTTCAT 97
GACCAAGGAGTCTAACATATGTGCAAGTT 25
CGTACCGGTAGGATCCGTTGTTTTTAGGGACGATCG 1
TATTATGAGAATAGTGTGCATTTT 47
GTTTGTGCGCCAGCAAGAGATA 1
CGCCCTAGCTCTAACCATA 4
GTGGGTAGGGGCATCCTCTAGACACCCTACAC 1
ATAGAGCAAAAGGGCAAATGCTGA 14
TCATAATAACTTTTCGAATCGCATG 2
TCGTAGGCGCCATCAATCGTATGCCGTCTTTTT 1

Total number of rows: 646990

Table truncated, full table size 17480 Kbytes.




Supplementary file Size Download File type/resource
GSM360260_fastq.txt.gz 271.5 Mb (ftp)(http) TXT
Processed data included within Sample table
Raw data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap