NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM364902 Query DataSets for GSM364902
Status Public on Jan 30, 2009
Title small RNA from 12-24hr embryo
Sample type SRA
 
Source name Drosophila melanogaster 12-24hr embryo
Organism Drosophila melanogaster
Characteristics 12-24hr embryo
Canton S
Extracted molecule total RNA
Extraction protocol total RNA from 12-24hr embryo, ~18-26nt RNAs isolated using PAGE, ligation to adapters requires 5' monophosphate and 3' OH
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer
 
Description Small RNA data.
Data processing raw sequences were clipped by 3' linker sequences recognition, and select clipped sequences longer than 18 nt
 
Submission date Jan 27, 2009
Last update date May 15, 2019
Contact name Nicolas Robine
E-mail(s) robinen@mskcc.org
Organization name Memorial Sloan Kettering Cancer Center
Department Developmental Biology
Lab Eric Lai
Street address 1275 York Avenue, Box 252
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL9058
Series (1)
GSE12840 Drosophila melanogaster late embryo, larval, pupal and adult head small RNA libraries
Relations
SRA SRX003183
BioSample SAMN02195451

Data table header descriptions
SEQUENCE
COUNT number of times small RNA was sequenced

Data table
SEQUENCE COUNT
GATTTGTCTAGTTAATTC 1
AGTGTTATTGTGGGCCGGTACTATTACT 1
TGCAGGAGGGGGATAGCGAGCGGGC 1
TGGTCCATCTACTAGGAAAA 1
GATTGATAGCTCTTTCTCGAATCTATG 4
CGGTGGCGCAGTTGGCAGCGCGTA 1
TTGCAGCCACTCTGGTCCGTGCCAC 1
CGCCCCACCGGCAACTTCAGAC 1
CTGTATATTGGGTGCACTTCGTTTT 1
CTGGACTGTATTGCTAACCAGAT 1
GTGATTTCTGCCCAGTGATCT 1
TGCCAATCCAATGTGCTCT 1
GCATCGGTAGTTCAGTGGGGGAATGCT 1
CACTGGCGGCCACATGGT 1
CGTAGTTGAACTTGTGCTTCAT 33
AGGTGTATGCCTCTAATAA 1
TATTATGAGAATAGTGTGCATTTT 2
CTAACTGTGGTAATTCTAG 1
ATAGAGCAAAAGGGCAAATGCTGA 2
TACGAGTAGGATATCGATCTGGTGG 4

Total number of rows: 139805

Table truncated, full table size 3575 Kbytes.




Supplementary data files not provided
SRA Run SelectorHelp
Processed data included within Sample table
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap