NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM368182 Query DataSets for GSM368182
Status Public on Feb 07, 2009
Title healthy control tissue from patient1 (female)
Sample type SRA
 
Source name healthy nasopharyngeal tissue
Organism Homo sapiens
Characteristics tissue: clinically negative of NPC
Treatment protocol clinical dissection, frozen samples.
Extracted molecule total RNA
Extraction protocol From all samples, RNA species smaller than 200 bases were enriched with the mirVana miRNA isolation kit (Ambion, Austin, Texas, USA). The small RNAs from all 4 samples were separated on a denaturing 12,5% polyacrylamide (PAA) gel and stained with SYBRgreenII. As molecular mass standard a mixture of oligonucleotides was used that range in size between 15 and 30 bases. The population of miRNAs with a length of 15 – 30 bases was obtained by passive elution of the RNAs from the gel. The miRNAs were then precipitated with ethanol and dissolved in water. For cDNA synthesis the RNAs were first poly(A)-tailed using poly(A) polymerase followed by ligation of a RNA adapter to the 5´-phosphate of the miRNAs. First-strand cDNA synthesis was then performed using an oligo(dT)-linker primer and M-MLV-RNase H- reverse transcriptase. The resulting cDNAs were then PCR-amplified to about 20 ng/μl using the high fidelity polymerase Phusion (Finnzymes). The fusion primers used for PCR amplification were designed for amplicon sequencing according to the instructions of 454 Live Sciences. Barcode sequences for each cDNA species are attached to the 5'-ends of the cDNAs. cDNAs of 4 samples were mixed in equal amounts. The correct size range was obtained by separation of the mixed cDNAs on and electroelution of the 120 – 135 bp fraction from 6% PAA-gels followed by purification of the eluted cDNAs using Nucleospin Extract II (Macherey and Nagel). The cDNAs were pooled (Volume: 30 μl; Concentration: 13 ng/μl; dissolved in 5 mM Tris pH:8,5) and sent for 454 sequencing. Small RNA cloning was performed by Vertis Biotechnologie AG (Weihenstephan, Germany)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model 454 GS 20
 
Description Total endogenous small RNAs from control tissue of patient1
Data processing Processed data file contains the reads with 5' and 3' adapters removed. Same reads are sorted together and the numbers of repetitivity are illustrated
 
Submission date Feb 06, 2009
Last update date May 15, 2019
Contact name Gunter Meister
E-mail(s) meister@biochem.mpg.de
Organization name Max Planck Institute of Biochemistry
Department Center for Integrated Protein Science Munich (CIPSM)
Lab RNA Biology
Street address Am Klopferspitz 18
City Martinsried
ZIP/Postal code 82152
Country Germany
 
Platform ID GPL9178
Series (1)
GSE14738 Identification of novel Epstein-Barr Virus miRNA genes from Nasopharyngeal Carcinomas
Relations
SRA SRX012422
BioSample SAMN00004752

Data table header descriptions
SEQUENCE
COUNT counts

Data table
SEQUENCE COUNT
AAAAAAAAAAAAAAAAAAAGACGGGGCGGATGTCTC 1
AAAAAAAAAAAAATAACGAGTGTAATGTTTGGCCCG 1
AAAAAAAAAAAGGAGGCCCAGACAGCCAGGATGTTG 1
AAAAAAAAACGAAAAAACAGGGCCT 1
AAAAAAAAATAAGCCGTGGCGGCCGTAGCGAC 1
AAAAAAAAATAAGCCGTGGCGGCCGTAGCGC 1
AAAAAAACTAAAAGCCGTGATGG 1
AAAAAAATGCCTGGACGGCCGTAAGCGAC 1
AAAAAAGCAGTTGGTGT 1
AAAAAAGCTGGGTTGAGAGGGCG 2
AAAAAAGCTGGGTTGAGAGGGCGAATT 1
AAAAAAGCTGGGTTGAGAGGGCGATTT 1
AAAAAATAAGCCGTGGCGGCCTTAGCGC 1
AAAAAATGAGAACTGAATTCCATGGGTT 1
AAAAAATGCCTGGCGGCCGTAGCGAC 2
AAAAAATGGAGCAGCCTGG 1
AAAAACGTCGTGAGACAGTTTGGTCCCT 1
AAAAACTTCTTAGAGGACAAGTGGCGTTAC 1
AAAAAGACTGGGTTGAGAGG 1
AAAAAGCCAGTGGCGCG 1

Total number of rows: 9303

Table truncated, full table size 209 Kbytes.




Supplementary data files not provided
SRA Run SelectorHelp
Processed data included within Sample table
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap