|
| Status |
Public on Feb 27, 2020 |
| Title |
Bcell_PROCap_WT1_39536 |
| Sample type |
SRA |
| |
|
| Source name |
primary activated splenic B lymphocytes
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Rosa26ERT2-cre/+ primary B cells
treatment: 4-hydroxy tamoxifen (4-HT)
|
| Treatment protocol |
Primary acttivated B cells were activated for 28h prior to the addition of 2 mM 4-HT for 32h (total of 60 h B cell activation with 32h 4-HT treatment) and then harvested for all downstream applications.
|
| Growth protocol |
Primary mature B cells were isolated from spleens of Supt5hFl/- Rosa26ERT2-cre/+ and Rosa26ERT2-cre/+ mice, and cultured in complete RPMI medium with IL4/LPS stimulation.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Following cell membrane lysis with hypotonic buffer, nuclei were isolated via sucrose gradient density centrifugation. PRO-cap was performed as described (Kwak et al., 2013 and Mahat et al., 2016). Briefly, 20 million nuclei were used per reaction, and the run-on was performed for 5 minutes with biotin-NTPs followed by extraction of RNA with Trizol reagent (Thermo Fisher, 15596026) and subsequent enrichment of biotin-labeled RNA with anti-BrU beads.
After 3' end repair, Illumina-compatible 3' end RNA adapters were ligated. All free 5' end were dephosphorylated and capped 5'ends were enzymatically treated to remove the cap to ligate the Illumina-compatile 5' end RNA adapters. After Streptavidin enrichment of biotin labeld RNA, the library was reverse transcribed and amplified.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Library strategy: PRO-cap
The illumina reads were adapter trimmed on their 3’ ends with cutadapt(version 1.15; --match-read-wildcards -f fastq -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC).
Afterwards 5 nucleotides from their 5’ end were removed with fastx_trimmer (fastx_toolkit version 0.0.13; -Q33 -t 5 ).
The trimmed reads larger then 18nt were aligned with bowtie (version 1.0.0; -S -p 10 --trim5 0 --trim3 0 -v 2 --best --strata --tryhard -m 1 --phred33-quals --chunkmbs 256) to the mouse mm9 genome.
The aligned reads were sorted by position with samtools (version 0.1.19).
Strand specific and undirected occupancy profiles were generated with deeptools bamCoverage v2.2.2.
Genome_build: NCBI mm9
Supplementary_files_format_and_content: bigWig of rpm-normalized read densities
|
| |
|
| Submission date |
May 31, 2019 |
| Last update date |
Feb 27, 2020 |
| Contact name |
Tobias Neumann |
| Organization name |
IMP
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE132029 |
Regulation of enhancer transcription by Spt5 directly couples enhancer activation with enhancer function |
|
| Relations |
| BioSample |
SAMN11909939 |
| SRA |
SRX5938667 |
