 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 19, 2020 |
| Title |
15X+0X (2) |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T_15X+0X
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
ldsdnas subgroup combination: Peptide library generated by ldsDNA CMV-Kozak-<NNK>15 and <NNK>0-GFP-SV40 PAS
molecule subtype: PCR amplicon
|
| Treatment protocol |
HEK293T cells were seeded into 6-well plates the day before transfection (60% - 70% confluency). 500 ng/well of each input amplicons (total 1000 ng/well) were transfected into cells with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) reagent following standard protocol.
|
| Growth protocol |
The HEK293T cell line was maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, Hudson, NH, USA) containing 10% fetal bovine serum (FBS) with 1% penicillin-streptomycin solution at 37 degree with 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Forty-eight hours after transfection, total RNAs were extracted by RNAiso Plus (TaKaRa, Beijing, China) reagent. cDNAs were synthesized using the PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa) following standard protocol. KOD-Plus-Ver.2 DNA polymerase (Toyobo) was used to amplify the corresponding cDNA sequences surrounding ldsDNA junctions.
Library construction and high-throughput sequencing were conduct by Novogene (Beijing, China). Sequencing libraries were generated using TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) following the manufacturer’s recommendations and index codes were added.
The library quality was assessed on the Qubit Fluorometer and Agilent Bioanalyzer 2100 system. At last, the libraries were sequenced on an Illumina HiSeq 2500 platform and 250 bp paired-end reads were generated.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Paired-end reads from the original DNA fragments were merged using FLASH, a very fast and accurate analysis tool which was designed to merge paired-end reads when there are overlaps between reads 1 and reads 2.
Paired-end reads were assigned to each sample according to the unique barcodes. Nucleotide sequences generated by ldsDNA-based AND-gate genetic circuits were extracted by in-house Perl scripts. PCR primers used for library amplification are: Forward, [Barcode]TCAGATCCGCTAGCGCTACC; Reverse, [Barcode]GAACTTCAGGGTCAGCTTGC. the barcodes information in the "Supplementary Table 1 barcode.xlsx".
Reads were filtered by QIIME quality filters.
The fna file contains the nucleotide sequence of the peptide library (these sequences are not aligned with any reference sequence).
Genome_build: NA
Supplementary_files_format_and_content: fna files were generated for each sample.
|
| |
|
| Submission date |
Jul 22, 2019 |
| Last update date |
Jul 20, 2020 |
| Contact name |
Shuai Li |
| E-mail(s) |
shuai.li2001@gmail.com
|
| Phone |
+862223340123
|
| Organization name |
Tianjin Tumor Hospital
|
| Street address |
Huanhuxi Road
|
| City |
Tianjin |
| State/province |
Tianjin |
| ZIP/Postal code |
300060 |
| Country |
China |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE134671 |
Generation of highly diverse peptide library by linear-double-stranded DNA based AND gate genetic circuit in mammalian cells |
|
| Relations |
| BioSample |
SAMN12339597 |
| SRA |
SRX6489760 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3963136_15X+0X_2_A6.fna.gz |
478.7 Kb |
(ftp)(http) |
FNA |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
