NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM409321 Query DataSets for GSM409321
Status Public on Jun 08, 2009
Title Endogenous small RNAs from developing inflorescence of rice - replicate 3
Sample type SRA
 
Source name Infl3
Organism Oryza sativa
Characteristics tissue: 1-2.5 cm length inflorescence
stage: mid stage 7
3' adapter: TTTAACCGCGAATTCCAG
Extracted molecule total RNA
Extraction protocol Small RNA libraries were constructed using a method that requires the 5’ end of the small RNAs to be phosphorylated [Lau, N.C., Lim, L.P., Weinstein, E.G., Bartel, D.P. (2001) An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans Science, 294, 858–862]. Total cellular RNA was fractionated on a 15% acrylamide gel run in 8M urea and 1X TBE, and the region of the gel containing 16 to 28 nt RNAs was excised. The small RNAs were eluted in 0.3 M NaCl and ethanol precipitated with 2.8 volumes of ethanol. The small RNAs were ligated to one of three alternative RNA-DNA chimeric pre-adenylylated 3´-adaptor oligonucleotides (see elsewhere for specific adapter) in a reaction containing 20 uM 3´-adaptor, 50 mM Hepes pH 8.3, 5 mM MgCl2, 3 mM DTT, 5 ug/ ml BSA and 8% glycerol for 2 hr. The ligated small RNAs were gel isolated as described above and ligated to an RNA 5’ adaptor (ATCGTAGGCACCTGAAA) and subsequently gel isolated. The resulting RNAs were reversed transcribed and amplified by PCR. The resulting DNAs were gel purified and sequenced by 454 Life Sciences.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model 454 GS
 
Description 18-34nt small RNAs
Data processing 5' and 3' adapter sequences were identified by alignment, and RNA sequences between these were extracted. Often more than one RNA sequence could be obtained from a single 100nt sequence read.
 
Submission date May 27, 2009
Last update date Jun 11, 2013
Contact name Venkatesan Sundaresan
Organization name University of California Davis
Department Plant Biology
Lab Sundaresan
Street address One Shields Ave
City Davis
State/province CA
ZIP/Postal code 95616
Country USA
 
Platform ID GPL9388
Series (1)
GSE16350 Endogenous small RNAs of meristematic and a terminally differentiated tissue of rice.
Relations
BioSample SAMN02197723

Data table header descriptions
SEQUENCE small RNA sequence (DNA form)
COUNT number of times small RNA was sequenced

Data table
SEQUENCE COUNT
AAAAAAACATGGTCAGCTTGATAGC 2
AAAAAAACTAGCCGTTGGGGA 1
AAAAAAAGGGAAGACGACGC 1
AAAAAAAGTTGGAATCTAAACAGGG 1
AAAAAACAAACCCTGGGTTTGCG 1
AAAAAACCACGGGCACCAGCCAGC 1
AAAAAACCACGGGCGCCAAACAGC 1
AAAAAACTAATTTCAGAACTCGCC 2
AAAAAACTAGCCGTTGGGGA 1
AAAAAAGACACGGATATTAAGGAA 1
AAAAAAGAGAGAAGAGTAGCGGGC 1
AAAAAAGAGTGTCATCTGTGACGG 1
AAAAAAGGCAAACCCTGTGTATGA 1
AAAAAAGTAGGAATTCTATCCA 1
AAAAAATAAACCGGGTGAAGCAGAC 1
AAAAAATGAAATGAGGTCCTGTAA 3
AAAAAATGAACTAAGAAGCCAGAAG 2
AAAAAATGAACTACGGGGGTGGAGC 1
AAAAAATGCCACTACTATTCGCGAT 1
AAAAAATGCTACCGATGGGGAT 1

Total number of rows: 80071

Table truncated, full table size 2056 Kbytes.




Supplementary file Size Download File type/resource
GSM409321_Infl_raw.fna.gz 11.9 Mb (ftp)(http) FNA
GSM409321_Infl_raw.qual.gz 25.2 Mb (ftp)(http) QUAL
Raw data provided as supplementary file
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap