NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM417785 Query DataSets for GSM417785
Status Public on Dec 09, 2009
Title Mitochondrial ESTs from males of D. melanogaster
Sample type SRA
 
Source name D. melanogaster males
Organism Drosophila melanogaster
Characteristics gender: male
strains: 14021-0231.36 and 14021-0231.15
developmental stage: Adults
tissue: Whole body
Growth protocol Flies were grown at 20°C in standard cornmeal medium. Newly emerged males and females were collected separately and allowed to age from 3 to 7 days.
Extracted molecule total RNA
Extraction protocol Total RNA was extracted with Trizol (Invitrogen) from 30 flies (three replicates of 10 flies each). RNA samples were treated with DNase I (10 units/50 mg of total RNA) and the absence of contaminating genomic DNA was confirmed by PCR. First-strand cDNA was generated from approximately 5 mg of total RNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas) according to manufacturer's instructions. The synthesis was carried out using a biotinylated oligo(dT) fused to the 454 sequencing primer B (5'-Biotin-GCCTTGCCAGCCCGCTCAG(T)17V-3', where V stands for any base but T). Double-stranded cDNA was synthesized by addition of 30 U of E. coli DNA polymerase I, and 1 U of E. coli Ribonuclease H to the first- strand synthesis reaction, following Fermentas' suggested protocol for second strand cDNA synthesis.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model 454 GS 20
 
Description Mitochondrial ESTs from males from reciprocal crosses of D. melanogaster strains 14021-0231.36 and 14021-0231.15 .
Expression profiles of D. melanogaster mitochondrial protein coding genes and rRNA genes from the library prepared with male flies.
library strategy: EST
library source: non-genomic
library selection: cDNA
Data processing Alignment of the 454-ESTs to annotated mitochondrial transcripts was performed on PanGEA (available at www.kofler.or.at/bioinformatics). We used the 5.5 release of transcript annotations of D. melanogaster as a reference data set, correcting the transcripts for the genes atp6, atp8, nad4 and nad4L that were not annotated as bi-cistronic transcripts. For D. pseudobscura we used the assembled and annotated mitochondrial genome (FJ899745). Only reads with at least 95% identity with a sequence in the database over at least 60% of their length were considered. The numberof ESTs that mapped to a given transcript was taken as the absolute expression level for that gene. Expression levels were normalized by dividing the number of ESTs mapped to each mitochondrial transcript by the total number of ESTs in the library (see Series GSE16651 supplementary file).
The Sample data tables represent the four libraries generated in our study. Each row contains one sequence, the the number of times it was sequenced and the mitochondrial gene it was mapped to. The 3' linker and the poly-A tail were removed from these sequences.
 
Submission date Jun 16, 2009
Last update date Jun 11, 2013
Contact name Tatiana Teixeira Torres
E-mail(s) tttorres@unicamp.br
Organization name Unicamp
Department CBMEG
Lab Lab Genetica Animal e Evolucao
Street address Rua Candido Rondon, 400
City Campinas
State/province SP
ZIP/Postal code 13083-875
Country Brazil
 
Platform ID GPL9772
Series (1)
GSE16651 Characterization of Drosophila mitochondrial transcripts through high throughput EST data
Relations
BioSample SAMN02197712

Data table header descriptions
SEQUENCE sequence of library read
COUNT the number of times sequenced
GENE mitochondrial gene mapped to

Data table
SEQUENCE COUNT GENE
AAAAAACTTTTAATTTTTTAAAAACATAAATTTATGAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCG 134 rrnL
AAACTTTTAATTTTTTAAAAACATAAATTTATGAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCG 90 rrnL
AAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAG 63 rrnL
ATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGA 62 rrnL
GAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAG 53 rrnL
ATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCGACTTTTAAATTCTTACA 41 rrnL
AAAACTTTTAATTTTTTAAAAACATAAATTTATGAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCG 38 rrnL
GGAAATACAGGACCTTCTATATCTTATATTTTAGTAACATTTTTATTAATAGCTCAAATTGCTTTATTAGTATTAGAATCAGCTGTAGCTATAATTCAATCTTA 37 atp8_atp6
ATAAAAATATTTTATTGGGGTGATATTAAAATTTAAAAAACTTTTAATTTTTTAAAAACATAAATTTATGAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAG 34 rrnL
TTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCGACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTAAGCCAGGTTGGTTTCTATCTTTAAAAAATTA 32 rrnL
GTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGT 31 rrnL
AAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCGACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTAAG 30 rrnL
GTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCGACTTTTAAATTCTTACA 29 rrnL
CGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCGACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTG 29 rrnL
AAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCGACTTTTAAATTCTTACATGATCTGAGTTCAAACCGGTGTAAG 28 rrnL
TTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGT 27 rrnL
CATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTG 26 rrnL
AAAATATTTTATTGGGGTGATATTAAAATTTAAAAAACTTTTAATTTTTAAAACATAAATTTATGAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTT 24 rrnL
CTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGATGTTGGATTAAGATATAATTTTGGGTGTAGCCGTTCAAATTTTAAGTCTGTTCG 24 rrnL
ATTTATGAATATTTGATCCATTAATAATGATTAAAAAATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTGGAGAGTTCATATCGATAAAAAAGATTGCGACCTCGA 24 rrnL

Total number of rows: 71143

Table truncated, full table size 12542 Kbytes.




Supplementary file Size Download File type/resource
GSM417785_dmel_m.fna.gz 1.8 Mb (ftp)(http) FNA
GSM417785_dmel_m.qual.gz 9.0 Mb (ftp)(http) QUAL
Raw data provided as supplementary file
Processed data included within Sample table
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap