NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM429419 Query DataSets for GSM429419
Status Public on Apr 12, 2010
Title 454-sequenced Cymbidium Ringspot Virus (CymRSV)-derived siRNAs
Sample type SRA
 
Source name Early systemic leaves of CymRSV-infected Nicotiana benthamiana
Organisms Nicotiana benthamiana; Cymbidium ringspot virus
Characteristics tissue: early systemic leaves
treatment: CymRSV infection
Growth protocol 3 weeks old Nicotiana benthamiana plants grown in soil under normal growth conditions were used for virus infection. After infection with CymRSV, plants were grown in fitotrons under a 14 h light (50 E µm-2s-1) and 10 h dark regime at 21°C
Extracted molecule total RNA
Extraction protocol Total RNA was extracted from early systemic leaves of Nicotiana benthamiana infected with CymRSV. The homogenized plant materials were resuspended in 600 \u03bcL of extraction buffer (0.1 M glycine-NaOH, pH 9.0, 100 mM NaCl, 10 mM EDTA, 2% SDS, and 1% sodium lauroylsarcosine) and mixed with an equal volume of phenol. The aqueous phase was treated with equal volumes of phenol and chloroform, precipitated with ethanol, and resuspended in sterile water and used in subsequent reactions.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model 454 GS
 
Description CymRSV-derived small RNAs from early systemic leaves of Nicotiana benthamiana.
Data processing Removed adaptors. Sequences without adapters were discarded. Small RNA sequences were mapped to the CymRSV genome (GenBank: X15511.1).
 
Submission date Jul 17, 2009
Last update date Jun 11, 2013
Contact name Simon Moxon
E-mail(s) simonm@cmp.uea.ac.uk
Organization name University of East Anglia
Street address University of East Anglia
City Norwich
State/province Norfolk
ZIP/Postal code NR4 7TJ
Country United Kingdom
 
Platform ID GPL15026
Series (2)
GSE17164 Structural and Functional Analysis of Viral siRNAs using 454 sequencing
GSE17278 Structural and Functional Analysis of Viral siRNAs
Relations
BioSample SAMN02198687

Data table header descriptions
SEQUENCE small RNA sequence (DNA form)
COUNT number of times small RNA was sequenced

Data table
SEQUENCE COUNT
AAAAAAAAAAAAAAAAAAATTAATCCGGCT 1
AAAAAAAAAAAAAAACTAAGGTGCTGGG 1
AAAAAAAAAAAAAATTCTCTCTTCAA 1
AAAAAAAAAAAAACTCCCTGGGTGTGAAA 1
AAAAAAAAAAAAAGTTACTTGCAAGGTG 1
AAAAAAAAAAAAATTGCCACCGG 1
AAAAAAAAAAAAATTTATGAGCGGGGT 1
AAAAAAAAAAAATTACCCTCTGGTAGAT 1
AAAAAAAAAAAATTCGGCGAA 1
AAAAAAAAAAACAAACTGCGGGGATG 1
AAAAAAAAAAACAATGTACTGGTCGAAAT 1
AAAAAAAAAAACTACCTTCGTGAA 1
AAAAAAAAAAATCATCCCCTGGGTGA 1
AAAAAAAAAAATCTGCCC 1
AAAAAAAAAAATTAATCCGGCTT 1
AAAAAAAAAAATTCATAGTGGTGGCT 1
AAAAAAAAAAATTCGTCTCACC 1
AAAAAAAAAAATTCTCTG 1
AAAAAAAAAACAATGTACTGGTCGAAAT 1
AAAAAAAAAACGACGTATGGAGGGCCC 1

Total number of rows: 33682

Table truncated, full table size 831 Kbytes.




Supplementary file Size Download File type/resource
GSM429419.fna.gz 2.3 Mb (ftp)(http) FNA
GSM429419.qual.gz 5.2 Mb (ftp)(http) QUAL
Raw data provided as supplementary file
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap