NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM444442 Query DataSets for GSM444442
Status Public on Feb 09, 2010
Title Mut-68_Chlamydomonas_rep2
Sample type SRA
 
Source name vegetative cells
Organism Chlamydomonas reinhardtii
Characteristics barcode: UC
small rna library: Mutation in Mut-68 gene
Growth protocol Cell were grown photoheterotrophically in Tris-Acetate-Phosphate (TAP) medium
Extracted molecule total RNA
Extraction protocol A conventional TRI Reagent extraction was performed to extract total RNA, followed by precipitation of the low molecular weight fraction
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer II
 
Description Low molecular weight RNA gel-sized in the ~18-33 nt range
Data processing Small RNA reads were analyzed after removal of 3' adapter (5' -TCGTATGCCGTCTTCTGCTTG) and filtering of 5' adapter (5'-GTTCAGAGTTCTACAGTCCGACGATC) or 3' adapter artifacts. Sequences were segregated into individual libraries according to their barcodes and the barcodes removed. Raw abundances were normalized according to the formula: normalized abundance (TPM)= raw/(total genome match - (t/r/sn/snoRNA/chloroplast/mitochondria)*1,000,000.
 
Submission date Aug 26, 2009
Last update date Jun 11, 2013
Contact name Linda Rymarquis
E-mail(s) rymarquis@dbi.udel.edu
Organization name University of Delaware
Street address 15 Innovation way rm 241
City Newark
State/province DE
ZIP/Postal code 19711
Country USA
 
Platform ID GPL9100
Series (1)
GSE17815 Uridylation of mature miRNAs and siRNAs by the MUT68 nucleotidyltransferase promotes their degradation in Chlamydomonas
Relations
BioSample SAMN02196617

Data table header descriptions
SEQUENCE
COUNT Normalized abundance (TPM) of each sequence in pooled library after removal of barcodes

Data table
SEQUENCE COUNT
AAGGTGTGGATGCGGCATG 0
AAGGTGTGGATGCGGCATGGG 0
CAGGCAGCGCGGGGCTGCT 2
CAGGCAGCGCGGGGCTGCTG 0
CAGGCAGCGCGGGGCTGCTGG 12
TGGAACCGGGCACGCAGG 0
TGGAACCGGGCACGCAGGAGG 15
TGGAACCGGGCACGCAGGAGGT 0
TGGGTAGTGTGGCGGCAGG 4
TGGGTAGTGTGGCGGCAGGC 7
TGGGTAGTGTGGCGGCAGGCA 39
TGGGTAGTGTGGCGGCAGGCAG 1092
TGGGTAGTGTGGCGGCAGGCAGC 257
TGGGTAGTGTGGCGGCAGGCAGCA 2
TTGGGGCCCAGCAGGTCCTGG 0
ATGGGTCCGATCGGGAAG 0
ATGGGTCCGATCGGGAAGC 0
ATGGGTCCGATCGGGAAGCT 0
ATGGGTCCGATCGGGAAGCTT 0
ATGGGTCCGATCGGGAAGCTTT 0

Total number of rows: 264129

Table truncated, full table size 6122 Kbytes.




Supplementary data files not provided
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap