GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM4523758 Query DataSets for GSM4523758
Status Public on Dec 07, 2020
Sample type SRA
Source name DDX3_DMSO2_ATP
Organism synthetic construct
Characteristics recombinant protein: SBP-tagged DDX3
treatment: DMSO
Treatment protocol DMSO or RocA for 30min
Extracted molecule total RNA
Extraction protocol A hundred pmol of SBP-tagged recombinant proteins (DDX3 helicase core or eIF4A1) was incubated with 60 ul of Dynabeads M-270 Streptavidin (Thermo Fisher Scientific), which were pre-equilibrated with equilibration buffer containing 1% Triton X-100, at 4 C for 30 min. Protein-tethered beads were treated with 2 U/ ul Micrococcal Nuclease (Takara) in 0.5 equilibration buffer, and 0.5% Triton X-100 in 30 l at 25 C for 30 min. After the incubation, the beads were washed 5 times with 60 l of equilibration buffer containing 1% Triton X-100, 1 M NaCl, and 5 mM EGTA pH 7.4, and rinsed twice with the same volume of equilibration buffer containing 0.1% Triton X-100. The rinsed beads were then incubated with 50 M oligonucleotide of 5c-*CTCTTTCCCTACACGACGCTCTTCCGATCT*-N30- *ATCGTAGATCGGAAGAGCACACGTCTGAA*-3T (letters in all capitals represent DNA sequence and N represents random RNA sequence) in 30 l of equilibration buffer containing 0.1% Triton X-100, 0.33 U/ l SUPERase In RNase Inhibitor (Thermo Fisher Scientific), 2 mM ADP and 2 mM Na2HPO4 with 3 M RocA (or 1% DMSO). Following reaction at 37 C for 30 min, the beads were washed 5 times with an equilibration buffer containing 0.1% Triton X-100, 2 mM ADP and 2 mM Na2 HPO4 with 3 M RocA (or 1% DMSO). Beads-tethered protein-RNA complex was eluted using 30 ul of equilibration buffer containing 0.1% Triton X-100, 5 mM D-biotin (Invitrogen), 2 mM ADP and 2 mM Na2HPO4 with 3 M RocA (or 1% DMSO) at 4 C for 30 min. Eluted RNAs were purified using Oligo Clean & Concentrator kit (Zymo Research) and transcribed into DNA library as described in ribosome profiling. RNA Bind-n-Seq with the condition of 2 mM AMP-PNP was performed as described above for the condition of 2 mM ADP and 2 mM Na2HPO4, but incubation with 1 M oligonucleotide.
Bind-n-Seq reference: PMID 24837674
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 4000
Description Bind-n-Seq
Processed data file for this sample is available on GSM4523757.
Data processing Library strategy: Bind-n-Seq
Basecalling with Illumina Casava 1.8 software
3' adapter trimming with FastX-toolkit
Supplementary_files_format_and_content: csv files contain the following values: 1) value: the number of tetramer motifs; 2) probability: the ratio of tetramer motifs to total of sample; 3) probability input: the ratio of tetramer motifs to total of input; 4) Rvalue: probability/probability input
Submission date May 08, 2020
Last update date Dec 07, 2020
Contact name Mingming Chen
Phone 07031428686
Organization name RIKEN
Department CPR
Lab RNA systems biochemistry lab
Street address Hirisawa 2-2
City Wakoshi
State/province Saitama
ZIP/Postal code 351-0106
Country Japan
Platform ID GPL21616
Series (1)
GSE150111 Dual targeting of DDX3 and eIF4A by the translation inhibitor rocaglamide A [Bind-n-Seq]
BioSample SAMN14854784
SRA SRX8293370

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap