NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4523759 Query DataSets for GSM4523759
Status Public on Dec 07, 2020
Title DDX3_input_ATP
Sample type SRA
 
Source name DDX3_input_ATP
Organism synthetic construct
Characteristics recombinant protein: SBP-tagged DDX3
binding constructs: CTCTTTCCCTACACGACGCTCTTCCGATCT*-N30-*ATCGTAGATCGGAAGAGCACACGTCTGAA
treatment: DMSO
Treatment protocol DMSO or RocA for 30min
Extracted molecule total RNA
Extraction protocol A hundred pmol of SBP-tagged recombinant proteins (DDX3 helicase core or eIF4A1) was incubated with 60 ul of Dynabeads M-270 Streptavidin (Thermo Fisher Scientific), which were pre-equilibrated with equilibration buffer containing 1% Triton X-100, at 4 C for 30 min. Protein-tethered beads were treated with 2 U/ ul Micrococcal Nuclease (Takara) in 0.5 equilibration buffer, and 0.5% Triton X-100 in 30 l at 25 C for 30 min. After the incubation, the beads were washed 5 times with 60 l of equilibration buffer containing 1% Triton X-100, 1 M NaCl, and 5 mM EGTA pH 7.4, and rinsed twice with the same volume of equilibration buffer containing 0.1% Triton X-100. The rinsed beads were then incubated with 50 M oligonucleotide of 5c-*CTCTTTCCCTACACGACGCTCTTCCGATCT*-N30- *ATCGTAGATCGGAAGAGCACACGTCTGAA*-3T (letters in all capitals represent DNA sequence and N represents random RNA sequence) in 30 l of equilibration buffer containing 0.1% Triton X-100, 0.33 U/ l SUPERase In RNase Inhibitor (Thermo Fisher Scientific), 2 mM ADP and 2 mM Na2HPO4 with 3 M RocA (or 1% DMSO). Following reaction at 37 C for 30 min, the beads were washed 5 times with an equilibration buffer containing 0.1% Triton X-100, 2 mM ADP and 2 mM Na2 HPO4 with 3 M RocA (or 1% DMSO). Beads-tethered protein-RNA complex was eluted using 30 ul of equilibration buffer containing 0.1% Triton X-100, 5 mM D-biotin (Invitrogen), 2 mM ADP and 2 mM Na2HPO4 with 3 M RocA (or 1% DMSO) at 4 C for 30 min. Eluted RNAs were purified using Oligo Clean & Concentrator kit (Zymo Research) and transcribed into DNA library as described in ribosome profiling. RNA Bind-n-Seq with the condition of 2 mM AMP-PNP was performed as described above for the condition of 2 mM ADP and 2 mM Na2HPO4, but incubation with 1 M oligonucleotide.
Bind-n-Seq reference: PMID 24837674
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 4000
 
Description Bind-n-Seq
Data processing Library strategy: Bind-n-Seq
Basecalling with Illumina Casava 1.8 software
3' adapter trimming with FastX-toolkit
Supplementary_files_format_and_content: csv files contain the following values: 1) value: the number of tetramer motifs; 2) probability: the ratio of tetramer motifs to total of sample; 3) probability input: the ratio of tetramer motifs to total of input; 4) Rvalue: probability/probability input
 
Submission date May 08, 2020
Last update date Dec 07, 2020
Contact name Mingming Chen
E-mail(s) mingming.chen@riken.jp
Phone 07031428686
Organization name RIKEN
Department CPR
Lab RNA systems biochemistry lab
Street address Hirisawa 2-2
City Wakoshi
State/province Saitama
ZIP/Postal code 351-0106
Country Japan
 
Platform ID GPL21616
Series (1)
GSE150111 Dual targeting of DDX3 and eIF4A by the translation inhibitor rocaglamide A [Bind-n-Seq]
Relations
BioSample SAMN14854783
SRA SRX8293371

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap