NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM455939 Query DataSets for GSM455939
Status Public on Nov 23, 2009
Title Rice_degradome_inflorescence
Sample type SRA
 
Source name rice young panicle
Organism Oryza sativa
Characteristics developmental stage: young panicle
Treatment protocol Total RNAs were isolated using Trizol per manufacturer's instructions, and subsequent mRNA purification was performed using oligo dT agarose beads.
Growth protocol Rice plants were grown in growth chambers with 12-h light/dark cycles, 28 oC during the day and 23 oC during the night.
Extracted molecule total RNA
Extraction protocol Degradome libraries were constructed as described (Nature Biotechnology, 2008, vol.26, 941-946)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina Genome Analyzer
 
Description mRNA fragments
Data processing The adaptor sequences in Illumina 1G sequencing reads were removed by using ‘‘vectorstrip’’ in the EMBOSS package. The RNA reads with length of 20–21 nt were mapped to the cDNA using Blast. Only RNAs with perfect cDNA matches were retained. Unique sequences were counted.
 
Submission date Sep 24, 2009
Last update date May 15, 2019
Contact name Yijun Qi
E-mail(s) qiyijun@nibs.ac.cn
Phone 86-10-80727837
Fax 86-10-80727873
URL http://www.nibs.ac.cn/?act=view&id=726
Organization name National Institute of Biological Sciences, Beijing
Street address No.7 Science Park Road,Zhongguancun Life Science Park
City Beijing
ZIP/Postal code 102206
Country China
 
Platform ID GPL9147
Series (2)
GSE18248 Sequencing of rice degradome
GSE18251 Identification of small RNAs in rice AGO1 complexes and their targets
Relations
SRA SRX014803
BioSample SAMN00006984

Data table header descriptions
SEQUENCE Unique sequences
COUNT count

Data table
SEQUENCE COUNT
CGAACTGTGAAACTGCGAAT 4
TCCTTCTGTGGCGTTGTCAA 2
GTAATTACAGGGCTGTCACTC 1
ACCGTGGGTGTTATAGCGGGA 1
TAAAGAATTCACCCAATGTGT 1
ATCACTAGGCGAGAAGGGGT 1
ATACGAGTTCGGAGGCTTAAG 1
GATTTGGATCAGATGTGCGG 1
CTCAGAGCTGGAGCTGCTTAT 1
TTGTTAGCCACTAGTCTTTC 2
CGACAATAAAAAAAATGGAT 17
TTCTGTTGTGTTGACGTTTC 1
TTGACTGTCAACTGCAGCAGA 4
CCACAATTCCGGTCTCTTGT 1
CATGGTTCGGTGCTTGCCTT 1
TCCAACAATATGCTTACCAT 1
ACGAGACCAGGAGCAGCCAT 8
AAATTTGTAATTCGATTAAA 1
AATTTAAAGTATTGTCTCGA 1
TTATCTGAACATTTCACAAAC 3

Total number of rows: 2505523

Table truncated, full table size 57480 Kbytes.




Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap