NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM455965 Query DataSets for GSM455965
Status Public on Nov 23, 2009
Title Rice_Total
Sample type SRA
 
Source name Seedling
Organism Oryza sativa
Characteristics protein complex: total extract
Treatment protocol RNAs were extracted from total extract and immunopurified AGO1 complexes by Trizol reagents. Bigger RNAs were removed by PEG precipitation, and enriched small RNAs were seperated on 15% PAGE/7M Urea gel, and small RNA within the range of 18-28 nt were purified from the gel.
Growth protocol Rice plants were grown in growth chambers with 12-h light/dark cycles, 28 oC during the day and 23 oC during the night.
Extracted molecule total RNA
Extraction protocol Small RNAs were ligated to a 3' adaptor and a 5' acceptor sequentially, and then RT-PCR amplified using a pair of Illumina cloning primers and then provided for Illumina sequencing.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer
 
Description small RNA
Data processing The adaptor sequences in Illumina 1G sequencing reads were removed by using ‘‘vectorstrip’’ in the EMBOSS package. The small RNA reads with length of 19–27 nt were mapped to the genome using Blast. Only small RNAs with perfect genomic matches were retained.
 
Submission date Sep 24, 2009
Last update date May 15, 2019
Contact name Yijun Qi
E-mail(s) qiyijun@nibs.ac.cn
Phone 86-10-80727837
Fax 86-10-80727873
URL http://www.nibs.ac.cn/?act=view&id=726
Organization name National Institute of Biological Sciences, Beijing
Street address No.7 Science Park Road,Zhongguancun Life Science Park
City Beijing
ZIP/Postal code 102206
Country China
 
Platform ID GPL9147
Series (2)
GSE18250 Profiling of small RNA populations in rice total extract and purified AGO1 complexes
GSE18251 Identification of small RNAs in rice AGO1 complexes and their targets
Relations
SRA SRX014807
BioSample SAMN00006988

Data table header descriptions
SEQUENCE Unique sequences
COUNT count

Data table
SEQUENCE COUNT
AAAAGCTGGAAAATAAACTGTGAT 1
TGTCGGTGACGCTCTTGGATACAC 1
ATTCGCTGTTTATGACATGTGGGT 1
TGAAAAAGTTAGAAGTTTGAAGA 3
GCCTTTGACTGAGGTGAGAGGGGG 3
AACATCATGTATGGTACATTTTGT 2
GTTGAATAATATGCCATCGT 1
TAACATCTAAATGAATGTGGG 8
TTACAGCTGACTTGTAACCTGCTA 1
ACTTAAGAAGTCCGCCTGGGTAT 1
CCTGGGATGCGCAAGGAAGCTGAC 1
GTTGACATGGATCTCTTGTAGATA 2
GTCTATTCGCCGCTTCAACAAAGA 1
GGTGAGGACTTAGTGCCTCTT 1
CCCCATTGCCATCTCTAGTGGA 1
ATCAAAGGATTTATGTAGAAATTT 1
CAGTATGGTATAGATAACCCAGA 1
ACCCAAGATAAGGATTACACAATT 1
AATATGTAACTATTGTATAAATGA 1
ACTTTTTGGGTCGTATGAAAAGGC 1

Total number of rows: 1991942

Table truncated, full table size 51459 Kbytes.




Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap