NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4616191 Query DataSets for GSM4616191
Status Public on May 26, 2021
Title WT_P_3AR (PEG_SHOCK_II)
Sample type SRA
 
Source name Arabidopsis thaliana seedling roots exposed to 30% PEG for 3h
Organism Arabidopsis thaliana
Characteristics tissue: Root
genotype: WT
treatment: 30% PEG for 3h
Treatment protocol For osmotic stress treatment, PEG average molecular weight 8,000 powder (Sigma-Aldrich) was used. For PEG solutions, 30% (w/v), PEG was dissolved in double-distilled (dd)H2O and pH was adjusted to 5.8 using HCl and KOH osmotic pressure measured at -2.0 MPa. Seedlings were exposed to 30% PEG for 0, 1, 2, 3 h in aqueous solution.
Growth protocol Arabidopsis (Arabidopsis thaliana; ecotype Columbia-0) and µlox seedlings (7 d old) were grown under white light in a 16-h-light/8-h-dark cycle at 21°C on Murashige and Skoog medium, supplemented with 1% (w/v) Suc and 0.8% (w/v) Phytoagar (Invitrogen).
Extracted molecule total RNA
Extraction protocol Three replicates of Arabidopsis seedlings (30 to 50 7-d-old seedlings per biological replicate) were used for each treatment. After treatment, the roots and shoots were separated, and RNA was extracted separately from frozen tissues using a standard Trizol extraction method (Sigma-Aldrich).
Libraries were prepared with the MARS-seq protocol (Diego Adhemar Jaitin, 2017) and sequenced using Illumina NextSeq 500 High Output v2 Kit (75 cycles).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description MARS-seq
X6F
Data processing Bcl files were converted into fastq by bcl2fastq. Demultiplexing is done using the sample barcode found on R2, the UMI found on R2 is inserted in the read name (in R1 fastq). R1 Fastq data submitted.
MARS-seq analysis was done using the UTAP transcriptome analysis pipeline (Kohen et al., 2019). Reads were trimmed using cutadapt, (parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a “A{10}” –times 2 -u 3 -u -3 -q 20 -m 25).
Reads were mapped to genome Tair-11 using STAR, v2.4.2a (parameters: –alignEndsType EndToEnd, –outFilterMismatchNoverLmax 0.05, –twopassMode Basic, –alignSoftClipAtReferenceEnds No).
The pipeline quantifies the 3’ of Araport annotated genes (The 3’ region contains 1,000 bases upstream of the 3’ end and 100 bases downstream):
We used the 3 end (1000bp) of the transcripts for counting the number of reads per gene. Counting (UMI counts) was done after marking duplicates (in-house script) using HTSeq-count (DOI: 10.1093/bioinformatics/btu638) in union mode.
Genome_build: Further analysis is done for genes having minimum 5 read in at least one sample.
Supplementary_files_format_and_content: Normalization of the counts and differential expression analysis was performed using DESeq2 , with the parameters: betaPrior=True, cooksCutoff=FALSE, independentFiltering=FALSE. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg.
 
Submission date Jun 15, 2020
Last update date May 26, 2021
Contact name Tomer Chen
E-mail(s) tomerlivechen@gmail.com
Organization name Weizmann Institute of Science
Department Plant and Environmental Sciences
Street address P.O.box 26
City Rehovot
ZIP/Postal code 7610001
Country Israel
 
Platform ID GPL19580
Series (2)
GSE152458 Transcriptome analysis of Arabidopsis thaliana shoots and roots, exposed to PEG-induced osmotic shock, PEG+Histidine, PEG+SHAM [20191204_125511_PEG_SHOCK_II]
GSE152462 A role for lipoxygenase in the production of 1O2 and promoting the root's response to osmotic stress in Arabidopsi
Relations
BioSample SAMN15237700
SRA SRX8547669

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap