 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 07, 2022 |
| Title |
sgRNAseq of Maxiprep of CRISPR TF library replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic stem cells
|
| Organism |
Mus musculus |
| Characteristics |
genotype: Ainv15(iNgn2 Tubb3::GFP)
treatment: No treatment
cell type: Embryonic stem cells
|
| Treatment protocol |
50 ng/µL Zeocin (Invivogen) was added to each well 24h later and transduced cells were maintained with Zeocin selection. To maintain 50-70% confluency throughout the screen, cells were transferred to 6-well plates (Thermo Fisher) on day 2 and selected for 3 additional days for a total of 5 days of selection. The first time point was obtained on day 5 post-selection. The second and third timepoints were taken on day 8 and day 12 while growing in ESC medium containing 50 ng/µL Zeocin.
|
| Growth protocol |
3 x 10^6 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 x 10^5 mESC cells per well. 4 h after cells were plated, the media was replaced with 8 µL of 100x concentrated library lentivirus mixed in 1 mL ESC medium with 1x polybrene (EMD Millipore). 16 h later, the virus solution was removed, cells were washed 1 time with PBS1X, and cells were split 1:2 to 10 12-well plates.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
In a 15 ml conical tube, we added 6 ml of NK Lysis Buffer (50 mM Tris (Boston BioProducts), 50 mM EDTA (Ambion), 1% SDS (Invitrogen), pH 8), and 30 μl of 20 mg/ml Proteinase K (Qiagen) to 9 million cells (>500 coverage) and incubated at 55°C overnight. 30 μl of 10 mg/ml RNAse A (Qiagen, diluted in NK Lysis Buffer to 10 mg/ml and then stored at 4 °C) was added to the lysed sample, which was then inverted 25 times and incubated at 37°C for 30 minutes. Samples were cooled on ice before the addition of 2 ml of pre-chilled 7.5M ammonium acetate (Sigma) to precipitate proteins. After adding ammonium acetate, the samples were vortexed at high speed for 20 seconds and then centrifuged at ≥ 4,000 x g for 10 minutes. After the spin, a tight pellet was visible in each tube and the supernatant was carefully decanted into a new 15 ml conical tube. 6 ml 100% isopropanol was added to the tube, inverted 50 times and centrifuged at ≥4,000 x g for 10 minutes. Genomic DNA was visible as a small white pellet in each tube. The supernatant was discarded, 6 ml of freshly prepared ice-cold 70% ethanol was added, the tube was inverted 10 times, and then centrifuged at ≥4,000 x g for 1 minute. The supernatant was discarded by pouring; the tube was briefly spun, and the remaining ethanol was removed using a P200 pipette. After air-drying for 10-30 minutes, the DNA changed appearance from a milky white pellet to slightly translucent. At this stage, 500 μl of 1x TE buffer (Sigma) was added, the tube was incubated at 65°C for 1 hour and at room temperature overnight to fully resuspend the DNA. The next day, the gDNA samples were vortexed briefly. The gDNA concentration was measured using a Nanodrop (Thermo Scientific).
5 PCR1 reactions were used for 52 µg of DNA for >500x coverage. Per PCR tube, 10.4 µg of genomic DNA was used in 100 µL volume with 0.4 µL Taq-B Polymerase (Enzymatics), 10X Taq buffer (Enzymatics), 10 mM dNTPs (NEB), 10 µM Fwd (5’ GAGGGCCTATTTCCCATGATTC) and Rvs (5’ GTTGCGAAAAAGAACGTTCACGG) using the following PCR protocol: Denaturation 94 °C for 30s, 25 cycles of 94 °C for 10s, 55 °C for 30s, 68 °C for 45s, final elongation 68 °C for 2 min. For the addition of Illumina barcodes, 5 staggered forward primers and 1 reverse primer with specific barcodes containing Illumina adaptors were mixed to obtain 10 µM primer mix. 2 PCR2 reactions were used per timepoint with 5 µL of PCR1 product amplified with 25 µL Q5 High Fidelity 2X Master Mix (NEB), 5 µL of 10 µM primer mix in 50 µL volume using the following PCR protocol: Denaturation 98 °C for 30s, 10 cycles of 98 °C for 10s, 65 °C for 30s, 72 °C for 45s, final elongation 72 °C for 5 min. All samples were pooled in equimolar ratio and PCR purified pooled sample with QIAquick PCR Purification Kit (Qiagen). The purified sample was then run on a 2% E-Gel and the correct size band was extracted for PCR2 (250-270 bp) and purified with QIAquick Gel Extraction Kit (Qiagen). The pooled library was then quantified with a Low-Range Quantitative ladder on 2% E-Gel. Libraries were then sequenced on Illumina MiSeq v3 for 150 cycles single end at the genomics core facility at NYU.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
genome-integrated sgRNAs
Maxiprep_CRISPR_TF_library_rep1
|
| Data processing |
Library strategy: sgRNA-seq
Sequences flanking the 20 nucleotide sgRNA sequence were trimmed using cutadapt.
Remaining 20 nucleotide sgRNA sequence reads were aligned to a library index generated by 17820 sgRNA sequences using bowtie.
Genome_build: mm10
Supplementary_files_format_and_content: TXT: tab-delimited text file containing output of featurecounts for Refseq genes.
|
| |
|
| Submission date |
Nov 06, 2020 |
| Last update date |
Jan 08, 2022 |
| Contact name |
Shaun Mahony |
| E-mail(s) |
mahony@psu.edu
|
| Phone |
814-865-3008
|
| Organization name |
Penn State University
|
| Department |
Biochemistry & Molecular Biology
|
| Lab |
Shaun Mahony
|
| Street address |
404 South Frear Bldg
|
| City |
University Park |
| State/province |
PA |
| ZIP/Postal code |
16802 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE160963 |
The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes [sgRNA-seq] |
| GSE160966 |
The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes |
|
| Relations |
| BioSample |
SAMN16686431 |
| SRA |
SRX9450249 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4886994_Maxiprep_counts_R1.txt.gz |
232.9 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
