|
| Status |
Public on Jul 01, 2021 |
| Title |
pTP::DCL3 dcl3 line1 meiocyte rep2_scBS-seq |
| Sample type |
SRA |
| |
|
| Source name |
Flower bud
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: Anther
cell type: Meiocyte
genotype: dcl3
|
| Treatment protocol |
No special treatment to all of the biological materials
|
| Growth protocol |
Arabidopsis plants were grown under 16h light/8h dark in a growth chamber (21°C, 70% humidity)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Male meiocyte of prophase I (mostly at pachytene stage) was isolated as described previously (Walker et;al 2018). To obtain tapetal cells, flower buds were harvested from the pA9::NTF marker line. Protoplasts were generated from the collected flower buds using a previously described method (ref). Isolated protoplasts were immediately subjected to FACS on a BD FACSMelody cell sorter.
Single cell bisufite sequencing (scBS-seq) libraries of male meiocyte from different genotypes were prepared according to the published low-input bisulfite squencing method (ref) whereas normal bisulfite sequencing libraries were constrcuted using the Ovation Ultralow Methyl-Seq Library System (Nugen, #0336) and EpiTect Fast Bisulfite Conversion (Qiagen, #59802) kits.
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
single cell BS-seq
|
| Data processing |
For BS-seq reads,low-quality reads, adaptor sequence and the the first 9 bp of 5’ end of each reads were removed using TrimGalore version 0.4.1 with default parameters. Filtered reads were then mapped to the Arabidopsis genome (TAIR10) using Bismark version 0.22.2(ref). Duplicated reads were removed using the Picard tools MarkDuplicates version 1.141 (https://github.com/broadinstitute/picard). Subsequent DNA methylation analysis was performed as previously described (ref).
For sRNA-seq, adaptor trimming was performed using Cutadapt( -u 1 -m 21 -M 25 -a TGGAATTCTCGGGTGCCAAGG ). Clean sRNA reads with lengths between 21-nt and 25-nt inclusive were then mapped to TAIR10 Arabidopsis reference genome using Bowtie (ref) with either 0 mismatches (-v 0) or up to 3 mismatches (-v 3). Abundance of 24-nt siRNA at each Hyper TE, cRdDM or MetGene locus was calculated using Reads Per Kilobase per Million (RPKM) of total mapped 24-nt sRNA reads.
For RNA-seq, low-quality reads and potential adaptor sequence were first trimmed using TrimGalore version 0.4.1 with default parameters. RNA-seq reads were mapped to the reference genome with the TopHat-2.0.10 and Cufflinks-2.2.1 packages.
Genome_build: TAIR10
Supplementary_files_format_and_content: gff files
|
| |
|
| Submission date |
Nov 17, 2020 |
| Last update date |
Jul 02, 2021 |
| Contact name |
Xiaoqi Feng |
| E-mail(s) |
xiaoqi.feng@jic.ac.uk
|
| Organization name |
John Innes Centre
|
| Department |
Cell and Developmental Biology
|
| Lab |
Xiaoqi Feng
|
| Street address |
Norwich Research Park
|
| City |
Norwich |
| State/province |
Norfolk |
| ZIP/Postal code |
NR4 7UH |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL19580 |
| Series (1) |
| GSE161625 |
Nurse cell-derived small RNAs define paternal epigenetic inheritance in Arabidopsis |
|
| Relations |
| BioSample |
SAMN16816824 |
| SRA |
SRX9520859 |
