NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4911364 Query DataSets for GSM4911364
Status Public on Jul 01, 2021
Title clsy2_meiocyte_rep2_scBS-seq
Sample type SRA
 
Source name Flower bud
Organism Arabidopsis thaliana
Characteristics tissue: Anther
cell type: Meiocyte
genotype: clsy2
Treatment protocol No special treatment to all of the biological materials
Growth protocol Arabidopsis plants were grown under 16h light/8h dark in a growth chamber (21°C, 70% humidity)
Extracted molecule genomic DNA
Extraction protocol Male meiocyte of prophase I (mostly at pachytene stage) was isolated as described previously (Walker et;al 2018). To obtain tapetal cells, flower buds were harvested from the pA9::NTF marker line. Protoplasts were generated from the collected flower buds using a previously described method (ref). Isolated protoplasts were immediately subjected to FACS on a BD FACSMelody cell sorter.
Single cell bisufite sequencing (scBS-seq) libraries of male meiocyte from different genotypes were prepared according to the published low-input bisulfite squencing method (ref) whereas normal bisulfite sequencing libraries were constrcuted using the Ovation Ultralow Methyl-Seq Library System (Nugen, #0336) and EpiTect Fast Bisulfite Conversion (Qiagen, #59802) kits.
 
Library strategy Bisulfite-Seq
Library source genomic
Library selection RANDOM
Instrument model Illumina NextSeq 500
 
Description single cell BS-seq
Data processing For BS-seq reads,low-quality reads, adaptor sequence and the the first 9 bp of 5’ end of each reads were removed using TrimGalore version 0.4.1 with default parameters. Filtered reads were then mapped to the Arabidopsis genome (TAIR10) using Bismark version 0.22.2(ref). Duplicated reads were removed using the Picard tools MarkDuplicates version 1.141 (https://github.com/broadinstitute/picard). Subsequent DNA methylation analysis was performed as previously described (ref).
For sRNA-seq, adaptor trimming was performed using Cutadapt( -u 1 -m 21 -M 25 -a TGGAATTCTCGGGTGCCAAGG ). Clean sRNA reads with lengths between 21-nt and 25-nt inclusive were then mapped to TAIR10 Arabidopsis reference genome using Bowtie (ref) with either 0 mismatches (-v 0) or up to 3 mismatches (-v 3). Abundance of 24-nt siRNA at each Hyper TE, cRdDM or MetGene locus was calculated using Reads Per Kilobase per Million (RPKM) of total mapped 24-nt sRNA reads.
For RNA-seq, low-quality reads and potential adaptor sequence were first trimmed using TrimGalore version 0.4.1 with default parameters. RNA-seq reads were mapped to the reference genome with the TopHat-2.0.10 and Cufflinks-2.2.1 packages.
Genome_build: TAIR10
Supplementary_files_format_and_content: gff files
 
Submission date Nov 17, 2020
Last update date Jul 02, 2021
Contact name Xiaoqi Feng
E-mail(s) xiaoqi.feng@jic.ac.uk
Organization name John Innes Centre
Department Cell and Developmental Biology
Lab Xiaoqi Feng
Street address Norwich Research Park
City Norwich
State/province Norfolk
ZIP/Postal code NR4 7UH
Country United Kingdom
 
Platform ID GPL19580
Series (1)
GSE161625 Nurse cell­-derived small RNAs define paternal epigenetic inheritance in Arabidopsis
Relations
BioSample SAMN16816912
SRA SRX9520871

Supplementary file Size Download File type/resource
GSM4911364_clsy2_meiocyte_rep2_sorted_dedup.CG.w1.gff.gz 25.1 Mb (ftp)(http) GFF
GSM4911364_clsy2_meiocyte_rep2_sorted_dedup.CHG.w1.gff.gz 28.3 Mb (ftp)(http) GFF
GSM4911364_clsy2_meiocyte_rep2_sorted_dedup.CHH.w1.gff.gz 111.4 Mb (ftp)(http) GFF
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap