NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4911386 Query DataSets for GSM4911386
Status Public on Jul 01, 2021
Title WT_meiocyte_sRNA-seq_rep2
Sample type SRA
 
Source name Flower bud
Organism Arabidopsis thaliana
Characteristics tissue: Anther
cell type: Meiocyte
genotype: WT
Treatment protocol No special treatment to all of the biological materials
Growth protocol Arabidopsis plants were grown under 16h light/8h dark in a growth chamber (21°C, 70% humidity)
Extracted molecule total RNA
Extraction protocol Meiocyte or tapetum cells was isolated using the same method as for BS-seq.Total RNA was then extracted from isolated pure meiocyte or tapetum cells using Direct-zol RNA Kit (Zymo, #R2061).
sRNA library was constructed using the RealSeq-Biofluids NGS Library Preparation Kit (Biocat,600-00048-SOM).To further enrich the small RNA fractions of the library and remove the potential adaptor dimers, the generated sRNA library was separated by electrophoresis with a 6% TBE gel (Novex, #EC6265BOX). The region containing DNA bands from 147 bp to 157 bp long (corresponding to 20-30 nt sRNA size) was excised with a knife and then resolved in elution buffer (0.5 M ammonium acetate, 10 mM magnesium sulfate, 1 mM EDTA (pH 8.0), 0.1% SDS) for 4 hours at 37°C. The remaining fragments of polyacrylamide were removed by passing the supernatant through a disposable plastic column. Two volumes of ethanol at 4°C were added to the solution and then stored on ice for 30 min. DNA was recovered by centrifugation for 10 min at 4°C in one microcentrifuge tube. Finally, the DNA was washed with 70% ethanol and resolved in Tris-EDTA (TE) buffer (pH 7.6).
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina NextSeq 500
 
Description sRNA-seq
Data processing For BS-seq reads,low-quality reads, adaptor sequence and the the first 9 bp of 5’ end of each reads were removed using TrimGalore version 0.4.1 with default parameters. Filtered reads were then mapped to the Arabidopsis genome (TAIR10) using Bismark version 0.22.2(ref). Duplicated reads were removed using the Picard tools MarkDuplicates version 1.141 (https://github.com/broadinstitute/picard). Subsequent DNA methylation analysis was performed as previously described (ref).
For sRNA-seq, adaptor trimming was performed using Cutadapt( -u 1 -m 21 -M 25 -a TGGAATTCTCGGGTGCCAAGG ). Clean sRNA reads with lengths between 21-nt and 25-nt inclusive were then mapped to TAIR10 Arabidopsis reference genome using Bowtie (ref) with either 0 mismatches (-v 0) or up to 3 mismatches (-v 3). Abundance of 24-nt siRNA at each Hyper TE, cRdDM or MetGene locus was calculated using Reads Per Kilobase per Million (RPKM) of total mapped 24-nt sRNA reads.
For RNA-seq, low-quality reads and potential adaptor sequence were first trimmed using TrimGalore version 0.4.1 with default parameters. RNA-seq reads were mapped to the reference genome with the TopHat-2.0.10 and Cufflinks-2.2.1 packages.
Genome_build: TAIR10
Supplementary_files_format_and_content: gff files
 
Submission date Nov 17, 2020
Last update date Jul 02, 2021
Contact name Xiaoqi Feng
E-mail(s) xiaoqi.feng@jic.ac.uk
Organization name John Innes Centre
Department Cell and Developmental Biology
Lab Xiaoqi Feng
Street address Norwich Research Park
City Norwich
State/province Norfolk
ZIP/Postal code NR4 7UH
Country United Kingdom
 
Platform ID GPL19580
Series (1)
GSE161625 Nurse cell­-derived small RNAs define paternal epigenetic inheritance in Arabidopsis
Relations
BioSample SAMN16816926
SRA SRX9520893

Supplementary file Size Download File type/resource
GSM4911386_WT_meiocyte_rep2_24nt_sRNA_abundance.w1.gff.gz 17.4 Mb (ftp)(http) GFF
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap