NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4911395 Query DataSets for GSM4911395
Status Public on Jul 01, 2021
Title WT_pollen_RNA-seq_rep3
Sample type SRA
 
Source name Open flower
Organism Arabidopsis thaliana
Characteristics tissue: Anther
cell type: Pollen
genotype: WT
Treatment protocol No special treatment to all of the biological materials
Growth protocol Arabidopsis plants were grown under 16h light/8h dark in a growth chamber (21°C, 70% humidity)
Extracted molecule total RNA
Extraction protocol Total RNA was extracted from either tapetum or pollen using TRIzol reagent (Invitrogen #15596026).
RNA-sequencing libraries were prepared with ScriptSeq V2 RNA-seq (Illumina, SSV21106) Library Prepararion and Ovarion RNA-Seq Systems (Nugen,0351) kit according to the manual.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description RNA-seq
WT_pollen_3reps_combined_no_rRNA_RNA_seq.log2_RPKM_w50.gff.gz
Data processing For BS-seq reads,low-quality reads, adaptor sequence and the the first 9 bp of 5’ end of each reads were removed using TrimGalore version 0.4.1 with default parameters. Filtered reads were then mapped to the Arabidopsis genome (TAIR10) using Bismark version 0.22.2(ref). Duplicated reads were removed using the Picard tools MarkDuplicates version 1.141 (https://github.com/broadinstitute/picard). Subsequent DNA methylation analysis was performed as previously described (ref).
For sRNA-seq, adaptor trimming was performed using Cutadapt( -u 1 -m 21 -M 25 -a TGGAATTCTCGGGTGCCAAGG ). Clean sRNA reads with lengths between 21-nt and 25-nt inclusive were then mapped to TAIR10 Arabidopsis reference genome using Bowtie (ref) with either 0 mismatches (-v 0) or up to 3 mismatches (-v 3). Abundance of 24-nt siRNA at each Hyper TE, cRdDM or MetGene locus was calculated using Reads Per Kilobase per Million (RPKM) of total mapped 24-nt sRNA reads.
For RNA-seq, low-quality reads and potential adaptor sequence were first trimmed using TrimGalore version 0.4.1 with default parameters. RNA-seq reads were mapped to the reference genome with the TopHat-2.0.10 and Cufflinks-2.2.1 packages.
Genome_build: TAIR10
Supplementary_files_format_and_content: gff files
 
Submission date Nov 17, 2020
Last update date Jul 01, 2021
Contact name Xiaoqi Feng
E-mail(s) xiaoqi.feng@jic.ac.uk
Organization name John Innes Centre
Department Cell and Developmental Biology
Lab Xiaoqi Feng
Street address Norwich Research Park
City Norwich
State/province Norfolk
ZIP/Postal code NR4 7UH
Country United Kingdom
 
Platform ID GPL19580
Series (1)
GSE161625 Nurse cell­-derived small RNAs define paternal epigenetic inheritance in Arabidopsis
Relations
BioSample SAMN16816959
SRA SRX9520902

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap