 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 15, 2022 |
| Title |
CH12_SNSSeq_shMcm_exp2_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
CH12
|
| Organism |
Mus musculus |
| Characteristics |
cell line: CH12
knockdown: shMcm
|
| Growth protocol |
CH12 cells cultured in complete RPMI medium wit IL4/CD40/TGF beta stimulation.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted and short nascent DNA was enriched via size selection and lamda exonuclease digestion
Libraries were prepared following standard Illumina protocols
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
SNS-seq
|
| Data processing |
Library strategy: SNS-seq
SNS-seq
The 3' adaptors were removed using cutadapt (v1.4.2, Read1: cutadapt --match-read-wildcards -O 4 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) and trimmed reads with a length of less than 18bp were discarded.
The trimmed reads were aligned to the mouse genome (mouse genome build NCBI m37, GCA_000001635.18) using bowtie (v 1.0.0, -v 2 --best --strata --tryhard -m 1 --chunkmbs 256)
replicates were pooled by condition and experiment with samtools merge 1.9 and peaks were called using MACS2 2.1.2.1 with --nomodel --extsize 275 -q 0.05 -g mm using sheared genomic DNA as control
Peak sets for each condition were overlapped between experiments with BEDTools intersect 2.27.1 using default parameters retaining only those peaks per condition that were found in both experiment
retained peaks were then clustered by genome-wide median interpeak distance with ClusterScan 0.2.1 using -n 2 and -d to 17,625 bp and 13,544 kb for WT and KD and peaks that are part of a cluster were retained
filtered peak sets were then merged merged with BEDTools merge 2.27.1
Genome_build: NCBI m37, GCA_000001635.18
Supplementary_files_format_and_content: CH12_unstimulated_IS.bed is a BED file containing the genomic positions of the merged initiation sites for WT and KD with the columns chrom, start, end, name, score, strand
Supplementary_files_format_and_content: CH12_unstimulated_IZ.bed is a BED file containing the genomic position of the clusters inferred by ClusterScan
|
| |
|
| Submission date |
Nov 19, 2020 |
| Last update date |
Sep 15, 2022 |
| Contact name |
Tobias Neumann |
| Organization name |
IMP
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE161821 |
DNA replication timing directly regulates the frequency of oncogenic chromosomal translocations [SNS-seq] |
| GSE161822 |
DNA replication timing directly regulates the frequency of oncogenic chromosomal translocations |
|
| Relations |
| BioSample |
SAMN16837358 |
| SRA |
SRX9532707 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
