|
Status |
Public on Apr 09, 2010 |
Title |
FC115_L6_M7_GGC |
Sample type |
SRA |
|
|
Source name |
TuMV
|
Organisms |
Arabidopsis thaliana; Turnip mosaic virus |
Characteristics |
time point: 10 dpi genotype: dcl234
|
Treatment protocol |
Plants were inoculated with enriched TuMV virion preparations or with buffer (mock).
|
Growth protocol |
Plants were grown in a greenhouse with a 16-hr light/8-hr dark cycle.
|
Extracted molecule |
total RNA |
Extraction protocol |
Small RNAs were separated from total RNA by size fractionation and converted to DNA amplicons by serial adaptor ligation to both ends followed by RT-PCR. DNA amplicons were sequenced using an Ilumina Genome Analyzer. 5' adaptor GUUCAGAGUUCUACAGUCCGACGAUC and 3' adaptor CTGTAGGCACCATCAAT
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer |
|
|
Description |
Single plant
|
Data processing |
Small RNA sequences were parsed from Illumina sequencing data files through identification of the 3' adaptor boundary and the 5' barcode. Only sequences that mapped perfectly to Arabidopsis thaliana or to TuMV genomes were included in the analysis.
|
|
|
Submission date |
Feb 04, 2010 |
Last update date |
Jun 11, 2013 |
Contact name |
James C Carrington |
E-mail(s) |
jcarrington@danforthcenter.org
|
Phone |
314-587-1202
|
Organization name |
Donald Danforth Plant Science Center
|
Lab |
James C. Carrington
|
Street address |
975 North Warson Road
|
City |
Saint Louis |
State/province |
MO |
ZIP/Postal code |
63132 |
Country |
USA |
|
|
Platform ID |
GPL10065 |
Series (1) |
GSE20197 |
Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
|
Relations |
BioSample |
SAMN02196456 |