NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM518295 Query DataSets for GSM518295
Status Public on Oct 01, 2010
Title zebrafish embryo 15h after fertilization
Sample type SRA
 
Source name zebrafish developing embryo
Organism Danio rerio
Characteristics anchor: NlaIII
tag length: 22
tag count: 620402
strain: Tg(fli1:EGFP)y1albino b4/b4)
tissue: whole embryo after fertilization
developmental stage: 15h after fertilization
Extracted molecule total RNA
Extraction protocol ds-cDNA was synthesized using biotinylated dT primer. After digestion of cDNA with anchoring enzymes (NlaIII, DpnII or BfaI), digested fragments were associated with streptavidin magnetic beads. Adapters were ligated to cDNA ends on the beads and adapter-cDNA was digested with EcoP15I. Released fragments after enzyme digestion were ligated to adapter encoding barcode. Obtained fragments were once amplified PCR and applied to sequence analysis.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina Genome Analyzer II
 
Description Embryo was collected at 15h after fertilization.
Data processing Sequece reads were sorted by barcode into separate files. From each read in each file, 26-bp sequence upstream anchoring enzyme site (CATG, GTAC or CTAG) was extracted. Extracted 26-bp sequences (tags) were count. These process was done by script written in Perl.
Tags were extracted from sequence data of multiplexed samples, which were analyzed by Illumina Genome Analyzer IIx.
 
Submission date Mar 05, 2010
Last update date Jun 11, 2013
Contact name Hideo Matsumura
E-mail(s) hideoma@shinshu-u.ac.jp
Phone 81-268-21-5800
Organization name Shinshu University
Department Gene Research Center
Street address Tokita 3-15-1
City Ueda
State/province Nagano
ZIP/Postal code 3868567
Country Japan
 
Platform ID GPL9319
Series (1)
GSE20682 High-throughput SuperSAGE for digital gene expression analysis of multiple samples using Next Generation Sequencing
Relations
BioSample SAMN02196166

Data table header descriptions
SEQUENCE
COUNT

Data table
SEQUENCE COUNT
AGGCAGACCGTTGCTGTCGGCG 5503
TGAACTGTTTTGGACATTCCTC 4987
TCTGTTTAACATCAATAAAACA 3682
CAGGACTTGCGTTCTCTCTAAT 2987
CATCTCCTGTCTGGTGGTGTCA 2830
GAGCCTATTAAACGAAAACGTT 2775
CAGTACTGCGGAGTTTAATAAA 2735
GAAACATCAATAAATCAGGGTT 2671
GGCTTCGGTCTGTTCGACTAAA 2596
TTTGTGCACTGATGTTTTTGAA 2503
ATTTAGCCAACACCACTAAGCA 2466
CTGCCACCTCAGTAAACCCACA 2408
GGATTCGGACTCTTTGACTAAA 2397
ATTTTCAAAATAAAACAACTGA 2310
AGGCTGTCTGTGCTGGAGTTTG 2250
GTCTACACGTTATTATTGGATC 2192
TCGGCTTCTCATTTCAGCAGAT 2169
CAAGGTGACCGGTCGCTGTGGT 2148
AAGTTACTGTGGAAAATACAAT 2112
CCCTTCATTACTGATGTCTTGT 2105

Total number of rows: 105314

Table truncated, full table size 2579 Kbytes.




Supplementary data files not provided
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap