|
| Status |
Public on Sep 15, 2022 |
| Title |
CH12_PROCap_WT |
| Sample type |
SRA |
| |
|
| Source name |
CH12
|
| Organism |
Mus musculus |
| Characteristics |
agent: unstimulated
genotype: WT
|
| Treatment protocol |
no treatment
|
| Growth protocol |
CH12 cells cultured in complete RPMI medium
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were harvested and nuclei isolated. Transcription run-on in the presence of all 4 biotynilated NTPs.After trizol extraction of total RNA
total extraction with trizol, labeled RNA enrichement .3' and 5' linker attachment. cDNA preparation and PCR
Single molecule indexing with random 10-mers via adapter ligation.TrusSeq indexed primers for multiplexing were used in the PCR step to generate barcoded libraries
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
RNA was generated by performing transcription run-on on freshly isolated nuclei
True-seq barcoded primers for multiplexing were used in the PCR step to generate barcoded libraries
PRO-cap
|
| Data processing |
Library strategy: PRO-cap
The Illumina reads were adapter trimmed on their 3′ ends using cutadapt v1.15; --match-read-wildcards -f fastq -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC).
Afterwards, four nucleotides from their 5′ end were removed with fastx_trimmer (http://hannonlab.cshl.edu/fastx_toolkit; version 0.0.13; -Q33 -t 5).
The trimmed reads >18 nucleotides were aligned with bowtie v1.0.0 (-S -p 10 --trim5 0 --trim3 0 -v 2 --best --strata --tryhard -m 1 --phred33-quals --chunkmbs 256) to the mouse mm9 genome.
The aligned reads were sorted by position with samtools v1.9.
Strand-specific and undirected occupancy profiles were generated with deepTools bamCoverage v2.2.2.
Genome_build: NCBI mm9
Supplementary_files_format_and_content: bigWig of rpm-normalized read densities
|
| |
|
| Submission date |
Apr 07, 2021 |
| Last update date |
Sep 15, 2022 |
| Contact name |
Tobias Neumann |
| Organization name |
IMP
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE161822 |
DNA replication timing directly regulates the frequency of oncogenic chromosomal translocations |
| GSE171623 |
DNA replication timing directly regulates the frequency of oncogenic chromosomal translocations [PRO-cap] |
|
| Relations |
| BioSample |
SAMN18646946 |
| SRA |
SRX10531588 |
