|
Status |
Public on May 24, 2024 |
Title |
MBT RNA-seq rep2 |
Sample type |
SRA |
|
|
Source name |
MBT zebrafish embryo
|
Organism |
Danio rerio |
Characteristics |
strain: Tubingen tissue: embryo developmental stage: sphere stage
|
Growth protocol |
Zebrafish (strain Tübingen) embryos were incubated at 28C
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was extracted from dechorinated and deyolked zebrafish embryos (4 hpf (MBT) and 5.3 hpf (post-MBT) ) using the Norgen Animal and Tissue RNA Extraction Kit (#25700) according to the manufacturer's instructions including the optional step of DNAse I treatment. 5ng of purified, total RNA was used to produce RNAseq libraries for each sample using the EpiCentre TotalScriptâ„¢ RNA-Seq Kit (#TSRNA12924). Briefly, total RNA was reverse-transcribed using random hexamer primers, followed by second-strand synthesis and adapter addition via tagmentation. The final RNA-Seq library was amplified by PCR for a total of 10 cycles.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
Raw reads were aligned to zv10 using Novoalign ( v2.8 novocraft) with the options [-o Sam -r All 50 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT] Bam files were generated using the SamTranscriptomeParser from the Useq packages (v8.8.8 default parameters) FPKM were calculated using the DefinedRegionDifferentialSeq from the Useq packages (v8.8.8 default parameters), which uses the DESeq2 R package for variance normalization and differential expression analysis. Genome_build: zv10 Supplementary_files_format_and_content: text files contains the FPKM values of the each replicate at MBT or post-MBT stages.
|
|
|
Submission date |
May 24, 2021 |
Last update date |
May 24, 2024 |
Contact name |
Bradley R Cairns |
E-mail(s) |
candice.wike@hci.utah.edu
|
Organization name |
Huntsman Cancer institute/HHMI
|
Department |
oncological Sciences
|
Street address |
2000 Cir of Hope Dr
|
City |
Salt Lake City |
State/province |
UT |
ZIP/Postal code |
84112 |
Country |
USA |
|
|
Platform ID |
GPL18413 |
Series (2) |
GSE175446 |
Distinctive roles for the chromatin remodeling ATPases Brg1 and Brm in early zebrafish embryos [RNA-seq] |
GSE175447 |
Distinctive roles for the chromatin remodeling ATPases Brg1 and Brm in early zebrafish embryos |
|
Relations |
BioSample |
SAMN19317928 |
SRA |
SRX10973751 |