NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM538831 Query DataSets for GSM538831
Status Public on Jul 06, 2010
Title SAGE_T9-3
Sample type SRA
 
Source name Mouse C2C12 myoblasts
Organism Mus musculus
Characteristics time: T9 (days)
cell type: Mouse C2C12 myoblasts
cell line: C2C12
protocol: SAGE
Treatment protocol To induce fusion into myotubes, proliferating cells were serum deprived by changing to a medium of DMEM supplemented with 2% FBS
Growth protocol Proliferating C2C12 mouse myoblasts were grown out on collagen coated plates in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS).
Extracted molecule total RNA
Extraction protocol For DeepCAGE, we used the protocol of Valenet al. 2009, but we used modified adapters in the 5' and 3' end ligation steps that have linker sequences (proliferating – CCGACAGGTTCAGAGTTCTACAGAGACAGCAG and differentiated - CCGACAGGTTCAGAGTTCTACAGCTTCAGCAG) for Illumina Genome Analyzer II sequencing and have a recognition site for EcoP15I used instead of MmeI. For DeepSAGE we used a FC-102-1005 DGE-Tag Profiling NlaIII SamplePrepKit from Illumina
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina Genome Analyzer II
 
Description DeepSAGE (3' sequencing)
Data processing Illumina GAPipeline, GAPSS analysis (www.lgtc.nl/GAPSS_R), custom Perl and R scripts
 
Submission date Apr 28, 2010
Last update date May 15, 2019
Contact name Peter A.C. 't Hoen
E-mail(s) p.a.c.hoen@lumc.nl
Phone +31 71 5269421
Fax +31 71 5268285
URL http://www.humgen.nl
Organization name Leiden University Medical Center
Department Center for Human and Clinical Genetics
Street address PO Box 9600
City Leiden
ZIP/Postal code 2300 RC
Country Netherlands
 
Platform ID GPL9250
Series (1)
GSE21580 DeepCAGE and DeepSAGE with proliferating and differentiated C2C12 mouse myoblasts
Relations
SRA SRX019942
BioSample SAMN00012309

Supplementary file Size Download File type/resource
GSM538831_sage_diff-3_f.wig.gz 3.4 Mb (ftp)(http) WIG
GSM538831_sage_diff-3_r.wig.gz 3.3 Mb (ftp)(http) WIG
SRA Run SelectorHelp
Processed data provided as supplementary file
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap