|
Status |
Public on Jul 06, 2010 |
Title |
CAGE_T0-3 |
Sample type |
SRA |
|
|
Source name |
Mouse C2C12 myoblasts
|
Organism |
Mus musculus |
Characteristics |
time: T0 (days) cell type: Mouse C2C12 myoblasts cell line: C2C12 protocol: CAGE
|
Treatment protocol |
To induce fusion into myotubes, proliferating cells were serum deprived by changing to a medium of DMEM supplemented with 2% FBS
|
Growth protocol |
Proliferating C2C12 mouse myoblasts were grown out on collagen coated plates in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS).
|
Extracted molecule |
total RNA |
Extraction protocol |
For DeepCAGE, we used the protocol of Valenet al. 2009, but we used modified adapters in the 5' and 3' end ligation steps that have linker sequences (proliferating – CCGACAGGTTCAGAGTTCTACAGAGACAGCAG and differentiated - CCGACAGGTTCAGAGTTCTACAGCTTCAGCAG) for Illumina Genome Analyzer II sequencing and have a recognition site for EcoP15I used instead of MmeI. For DeepSAGE we used a FC-102-1005 DGE-Tag Profiling NlaIII SamplePrepKit from Illumina
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
CAGE |
Instrument model |
Illumina Genome Analyzer II |
|
|
Description |
DeepCAGE (5' sequencing)
|
Data processing |
Illumina GAPipeline, GAPSS analysis (www.lgtc.nl/GAPSS_R), custom Perl and R scripts
|
|
|
Submission date |
Apr 28, 2010 |
Last update date |
May 15, 2019 |
Contact name |
Peter A.C. 't Hoen |
E-mail(s) |
p.a.c.hoen@lumc.nl
|
Phone |
+31 71 5269421
|
Fax |
+31 71 5268285
|
URL |
http://www.humgen.nl
|
Organization name |
Leiden University Medical Center
|
Department |
Center for Human and Clinical Genetics
|
Street address |
PO Box 9600
|
City |
Leiden |
ZIP/Postal code |
2300 RC |
Country |
Netherlands |
|
|
Platform ID |
GPL9250 |
Series (1) |
GSE21580 |
DeepCAGE and DeepSAGE with proliferating and differentiated C2C12 mouse myoblasts |
|
Relations |
SRA |
SRX019946 |
BioSample |
SAMN00012313 |