|
| Status |
Public on Oct 18, 2023 |
| Title |
K562_library2_3_gRNA amplification |
| Sample type |
SRA |
| |
|
| Source name |
K562 cell line
|
| Organism |
synthetic construct |
| Characteristics |
treatment: tranduced with a CRISPR KO library 2(molncRNA(-/-)+IC gRNA)
cell line: K562
|
| Treatment protocol |
gRNAs were connected to the tandem double gRNA expression plasmid (pLV-hEF1a-EGFP-2A-Puro-U6-gRNA1-7sK-gRNA2) to obtain the gRNA libraries expressing EGFP green fluorescence. 3×106 of K562 cells in 7.5 ml media plus 8 µg/ml polybrene were transduced, with either of the gRNA-EGFP (MOI ~4) or Cas9-mCherry (MOI ~50) expressing viruses that had been packaged singly. At 72 hours post-infection, gRNA-EGFP+/Cas9-mCherry+ cells were collected by flow-cytometry and subjected to Single-cell RNA-seq.
|
| Growth protocol |
(Sample 8-14) Human erythroleukemia cell line K562 was maintained in RPMI1640 supplemented with 10% FBS (Gibco, Carlsbad, CA, USA).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The enriched PCR procedure was performed as described previously(Hill et al., 2018) with the following modifications. A heminested PCR starting from 40 ng of full-length cDNA was used to enrich for gRNA barcodes. Q5 High-Fidelity DNA Polymerase (New England BioLabs) was used for PCR amplification according to the following PCR protocol: (1) 98°C for 45 s, (2) 98°C for 15 s, 65°C for 20 s, then 72°C for 60 s (14-16 cycles). PCRs were cleaned with Zymo DNA Clean & Concentrator-5 columns (Zymo, Orange County, CA, USA) and 15 µl of a 1:2 dilution of the first PCR and 1:2 dilution of the second PCR were carried in each reaction. Then fragments of length 400-500 bp were selected using 8% TBE gel.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
gRNA amplification library for 10X cDNA samples (K562_library2_3)
library2_gRNA_whitelist.txt.gz
Sample 14
|
| Data processing |
Library strategy: amplified gRNA sequencing
All 10x scRNA-seq datasets were processed with the Cell Ranger (v3.0.2) pipeline (https://www.10xgenomics.com/) and were mapped to the Homo sapiens genome (Ensembl GRCh38.p12). This step yields a total of 71,014 cells, and an average of 52,758 reads per cell; 3,326 median genes per cell, and a median of 17,478 UMIs per cells.
Libraries of gRNA amplification were separately indexed and sequenced as spike-ins alongside the scRNA-seq libraries. UMI and cell-barcode assignments were made for each read by processing these samples with the Cell Ranger (v3.0.2) 'count' tools. Then, we combined the output bam files and the whitelist of guides sequence in our libraries to obtain the cell-barcode and guide pairwise using 'get_barcodes.py' (Hill et al., 2018) with parameters: "--search_seq TTGTGGAAAGGACGAAACACCG --all_reads --barcode_length 20 --no_swalign --chimeric_threshold 0.2". The similar chimeric sequences and reads unassigned to a gRNA were removed. Cell barcodes detected in the gRNA amplification libraries were then matched with cell-barcodes detected in the regular 10x scRNA-seq libraries. We take all whitelist sequences that have at least one UMI counts and account for over 7.5% of the whitelist reads assigned to a given cell using 'preprocess_cfg.R' tools (Hill et al., 2018).
Genome_build: Ensembl GRCh38.p12
Supplementary_files_format_and_content: Barcodes detected, genes detected and matrix h5 files are provided for each sample
Supplementary_files_format_and_content: *whitelist.txt: gRNA sequence list
|
| |
|
| Submission date |
Aug 02, 2021 |
| Last update date |
Oct 18, 2023 |
| Contact name |
Yue Huo |
| E-mail(s) |
yuehuo_hy@outlook.com
|
| Organization name |
Chinese Academy of Medical Sciences, School of Basic Medicine Peking Union Medical College
|
| Department |
State Key Laboratory of Medical Molecular Biology, Department of Biochemistry and Molecular Biology, Institute of Basic Medical Sciences
|
| Lab |
Key Laboratory of RNA and Hematopoietic Regulation
|
| Street address |
Dongcheng District, Dongdan 3 Tiao 5 Hao
|
| City |
Beijing |
| State/province |
Beijing |
| ZIP/Postal code |
100005 |
| Country |
China |
| |
|
| Platform ID |
GPL26697 |
| Series (1) |
| GSE181338 |
Dissecting long non-coding RNAs derived from microRNA genes in hematopoiesis (scRNA sequencing) |
|
| Relations |
| BioSample |
SAMN20522715 |
| SRA |
SRX11631449 |
