NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM573521 Query DataSets for GSM573521
Status Public on Aug 02, 2012
Title small RNAs from vegetative cells_SL14
Sample type SRA
 
Source name vegetative cells
Organism Chlamydomonas reinhardtii
Characteristics strain: cw15_325arg
3prime adaptor: TCGTATGCCGTCTTCTGCTTGT
Treatment protocol Small RNAs were isolated from different strains of Chlamydomonas and from cells at different phases of the Chlamydomonas sexual cycle. Genomic DNA was isolated from vegetative cells.
Growth protocol Chlamydomonas cells were grown in liquid culture.
Extracted molecule total RNA
Extraction protocol RNA was extracted using Trizol (Invitrogen) and small RNA isolated from the total RNA fraction using mirVana (Ambion), adapter sequences appropriate Illumina sequencing were ligated.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer
 
Description SL14.trimmed_reads.fasta.txt: the fasta file initially derived from the SL14 fastq file. This still has the illumina IDs in the description line for each sequence and has all sequences (i.e. they are not filtered), but the adaptor sequence 'TCGTATGCCGTCTTCTGCTTGT' has been removed. The original sequence may be reconstituted by adding sufficient bases from the adaptor (beginning at the 3prime end) to make 35bp. No further filtering has been done on this file. There are no quality scores.
Data processing Sequence reads were obtained using the Illumina Genome Analyzer Pipeline. The 3 prime adaptor sequence was removed from the small RNA reads and the reads were aligned to the Chlamydomonas genome, assembly 4. Only reads with 100% match to the genome were retained.
 
Submission date Aug 02, 2010
Last update date Jun 11, 2013
Contact name Krys Kelly
Organization name University of Cambridge
Department Plant Sciences
Lab Baulcombe Group
Street address Downing Street
City Cambridge
ZIP/Postal code CB2 3EA
Country United Kingdom
 
Platform ID GPL9152
Series (1)
GSE23379 Small RNA profiling of strains and lifecycle of Chlamydomonas reinhardtii
Relations
BioSample SAMN02195945

Supplementary file Size Download File type/resource
GSM573521_SL14.trimmed_reads.fasta.txt.gz 15.0 Mb (ftp)(http) TXT
GSM573521_SL14.v_Chlamydomonas_reinhardtii_genome.patman.aligned_reads.fasta.txt.gz 480.1 Kb (ftp)(http) TXT
Processed data provided as supplementary file
Raw data not provided for this record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap