NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5830476 Query DataSets for GSM5830476
Status Public on Apr 26, 2022
Title Rad21KO primary dissociated cortical neuron treated with TTX/D-AP5 Rep2 5C
Sample type SRA
 
Source name Primary neuron
Organism Mus musculus
Characteristics genotype: Rad21KO
treatment: TTX-Kcl
Extracted molecule genomic DNA
Extraction protocol Neuronal cultures were fixed in 1% formaldehyde for 10 minutes (room temp) via the addition (1:10 vol/vol) of the following fixation solution: 50 mM Hepes-KOH (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde. Fixation was quenched via the addition of 2.5 M glycine (1:20 vol/vol) and scraped into pellets. Each pellet was washed once with cold PBS, flash frozen, and stored at -80oC. For each condition, in situ 3C was performed on 2 replicates of 4-5 million cells as described (Beagan et al., 2020). Briefly, cells were thawed on ice and resuspended (gently) in 250 L of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630) with 50 L protease inhibitors (Sigma P8340). Cell suspension was incubated on ice for 15 minutes and pelleted. Pelleted nuclei were washed once in lysis buffer (resuspension and spin), then resuspended and incubated in 50 L of 0.5% SDS at 62oC for 10 min. SDS was inactivated via the addition of 145L H2O, 25 uL 10% Triton X-100, and incubation at 37oC for 15 min. Subsequently, chromatin was digested overnight at 37oC with the addition of 25 L 10X NEBuffer2 and 100U (5 L) of HindIII (NEB, R0104S), followed by 20 min incubation at 62oC to inactivate the HindIII. Chromatin was re-ligated via the addition of 100 L 10% Triton X-100, 120 L NEB T4 DNA Ligation buffer (NEB B0202S), 12L 10 mg/mL BSA, 718 L H2O, and 2000 U (5 L) of T4 DNA Ligase (NEB M0202S) and incubation at 16oC for 2 hours. Following ligation nuclei were pelleted, resuspended in 300 L of 10 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1% SDS, plus 25 L of 20 mg/mL proteinase K (NEB P8107), and incubated at 65oC for 4 hours at which point an additional 25 L of proteinase K was added and incubated overnight. 3C templates were isolated next day via RNaseA treatment, phenol-chloroform extraction, ethanol precipitation, and Amicon filtration (Millipore MFC5030BKS). Template size distribution and quantity were assessed with a 0.8% agarose gel.
5C primers were designed according to the double-alternating design scheme using the My5C primer design software (http://my5c.umassmed.edu/my5Cprimers/5C.php)10 with universal “Emulsion” primer tails. Regions were designed to capture TAD structures immediately surrounding the genes of interest (Bdnf, Fos, Arc, Neurexin-1, Neuroligin-3, Synaptotagmin-1) in published mouse cortex HiC data. 5C reactions were carried out as previously described. 600 ng (~200,000 genome copies) of 3C template for each replicate was mixed with 1 fmole of each 5C primer and 0.9 ug of salmon sperm DNA in 1x NEB4 buffer, denatured at 95oC for 5 min, then incubated at 55oc for 16 hours. Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 uL) Taq ligase (NEB M0208L) and incubation at 55oC for 1 hour then 75oC for 10 min. Successfully ligated primer-primer pairs were amplified using primers designed to the universal tails (FOR = CCTCTC TATGGGCAGTCGGTGAT, REV = CTGCCCCGGGTTCCTCATTCTCT) across 30 PCR cycles using Phusion High-Fidelity Polymerase. Presence of a single PCR product at 100 bp was confirmed via agarose gel, then residual DNA <100 bp was removed through AmpureXP bead cleanup at a ratio of 2:1 beads:DNA (vol/vol). 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer’s instructions with the following parameter selections: during size selection, 70 uL of AMPure beads was added at the first step and 25 at the second step; linkered fragments were amplified using 8 PCR cycles. A single band at 220 bp in each final library was confirmed using an Agilent DNA 1000 Bioanalyzer chip, and library concentration was determined using the KAPA Illumina Library Quantification Kit (#KK4835). Finally, libraries were evenly pooled and sequenced on the Illumina NextSeq 500 using 37 bp paired-end reads.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina NextSeq 500
 
Data processing Library strategy: 5C-seq
5C analysis steps were performed as described (Gilgenast et al., 2019; Beagan et al., 2020; Fernandez et al., 2020). Briefly, paired-end reads were aligned to the 5C primer pseudo-genome using Bowtie, allowing only reads with one unique alignment to pass filtering. Only reads for which one paired end mapped to a forward/left-forward primer and the other end mapped to a reverse/left-reverse primer were tallied as true counts. Primer-primer pairs with outlier count totals, resulting primarily from PCR bias, were identified as those with a count at least 8-fold higher (100-fold for the lower-quality Arc region) than the median count of the 5x5 subset of the counts matrix centered at the primer-primer pair in question; outlier counts were removed. Primer-primer pair counts were then converted to fragment-fragment interaction counts by averaging the primer-primer counts that mapped to each fragment-fragment pair (max of 2 if both a forward/left-forward and a reverse/left-reverse primer were able to be designed to both fragments and were not trimmed during outlier removal). We then divided our 5C regions into adjacent 4 kb bins and computed the relative interaction frequency of two bins (i,j) by summing the counts of all fragment-fragment interactions for which the coordinates of one of the constituent fragments overlapped (at least partially) a 12 kb window surrounding the center of the 4 kb ith bin and the other constituent fragment overlapped the 12 kb window surrounding the center if the jth bin. Binned count matrices were then matrix balanced using the ICE algorithm69,71 and quantile normalized across all 8 replicates (2 per condition) within each experimental set (neuronal activation and cohesin-rescue experimental datasets were quantile normalized separately) as previously described (Beagan et al., 2020), at which point we considered each entry (i,j) to represent the Observed Interaction Frequency of the 4 kb bins i and j. Finally, the background contact domain ‘expected’ signal was calculated using the donut background mode (Su et al., 2017) and used to normalize the relative interaction frequency data for the background interaction frequency present at each bin-bin pair. The resulting background-normalized interaction frequency (“observed over expected”) counts were fit with a logistic distribution from which p-values were computed for each bin-bin pair and converted into ‘Background-corrected Interaction Scores’ (interaction score = -10*log2(p-value)), which have previously shown to be informatively comparable across replicates and conditions (Beagan et al., 2020).
Genome_build: mm9 5C primer psuedogenome
Supplementary_files_format_and_content: BED_6715-mm9-ERneuro.bed' is the bed file containing the coordinates for each 5C primer used in the neuronal activity experiments. 'BED_6718-mm9-synapt.bed' is the bed file containing the coordinates for each 5C primer used in the cohesin rescue experiments. '[Rep_name].counts.txt' contains the number of reads mapped to each pair of 5C primers (see 5C processing) for each replicate.
 
Submission date Jan 21, 2022
Last update date Apr 26, 2022
Contact name LMS Bioinformatics Core
E-mail(s) bioinformatics@lms.mrc.ac.uk
Organization name MRC London Institute of Medical Sciences
Department Bioinformatics Core
Street address Hammersmith Hospital Campus, Du Cane Road
City London
ZIP/Postal code W12 0NN
Country United Kingdom
 
Platform ID GPL19057
Series (2)
GSE172429 Activity-induced gene expression and long-range enhancer-promoter contacts in cohesin-deficient neurons
GSE194197 Reliance of neuronal gene expression on cohesin scales with chromatin loop length (5C)
Relations
BioSample SAMN25162162
SRA SRX13861130

Supplementary file Size Download File type/resource
GSM5830476_proj36-Felix-Rad21KO-TTX-Kcl-rep3-activity-WG3CWG5C-S1_S8.counts.txt.gz 23.9 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap