NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5852961 Query DataSets for GSM5852961
Status Public on Jun 18, 2022
Title DOG_1_H_uc
Sample type SRA
 
Source name Heart
Organism Canis lupus familiaris
Characteristics tissue: Heart
Sex: f
individual: 1
age: adult
sample type: unconverted
Treatment protocol NA
Growth protocol NA
Extracted molecule genomic DNA
Extraction protocol Reduced representation bisulfite sequencing (RRBS) was performed as described in Klughammer et al., Cell Reports 2015, using 100 ng of genomic DNA for most samples, while occasionally going down to 1 ng for samples with low DNA amounts (Supplementary Table 1). To assess the bisulfite conversion efficiency independent of CpG context, methylated and unmethylated spike-in controls were added at a concentration of 0.1%. For most samples, DNA was digested using the restriction enzymes MspI and TaqI in combination (as opposed to only MspI in the original protocol) in order to increase genome-wide coverage. For certain older samples, only MspI was used
Restriction enzyme digestion was followed by fragment end repair, A-tailing, and adapter ligation. Fi-nally, the libraries were size selected by performing a 0.75× cleanup with AMPure XP beads (Beckman Coulter, A63881) retaining fragments of about 100 bp to 1000 bp length. The amount of effective li-brary was determined by qPCR, and samples were multiplexed in pools of 10 with similar qPCR Ct values. The pools were then subjected to bisulfite conversion, followed by library enrichment with PCR. Enrichment cycles were determined using qPCR and ranged from 6 to 18 (median: 11). After con-firming adequate fragment size distributions on Bioanalyzer High Sensitivity DNA chips (Agilent),
 
Library strategy Bisulfite-Seq
Library source genomic
Library selection Reduced Representation
Instrument model Illumina HiSeq 3000
 
Description DOG_consensus_reference.fa
Data processing Sequencing data were processed with illumina2bam-tools v. 1.12
BAM files were converted to fastq format using SamToFastq.jar (picard-tools v1.100) with the INCLUDE_NON_PF_READS parameter set to FALSE (implemented in RefFreeDMA)
All reads were trimmed for adapter sequences and low-quality sequences using trimgalore v0.3.3 with the following command: trim_galore -q 20 --phred33 -a "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" --stringency 1 -e 0.1 --length 16 --output_dir $output_dir $input_fastq.
Reference-free processing (creation of the deduced genomes and processing) was performed using the RefFreeDMA software/pipeline (http://RefFreeDMA.computational-epigenetics.org)
Bisulfite alignment of the RRBS reads to the deduced genomes and to the reference genomes was performed using BSMAP v2.74 with the following command line: bsmap -a $input_fastq -d $ref_genome_fasta -o $output_bam -D C-CGG -w 100 -v 0.08 -r 1 -p 4 -n 0 -S 1 -f 5 –u (implemented in RefFreeDMA).
DNA methylation calling was performed using the biseqMethCalling.py software (Bock, 2010)(implemented in RefFreeDMA).
Genome_build: processed files list contains consensus genomes for each of 580 species
Supplementary_files_format_and_content: Tab-delimited text files include CpG methylation calls for each sample. The columns in the file correspond to thr chromosome, start and end of a CpG region, rationof methylated/non metylated, mean methylation in ‰ and the strand.
 
Submission date Feb 01, 2022
Last update date Jun 18, 2022
Contact name Christoph Bock
E-mail(s) cbock@cemm.oeaw.ac.at
Organization name CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences
Street address Lazarettgasse 14
City Vienna
ZIP/Postal code 1090
Country Austria
 
Platform ID GPL27015
Series (1)
GSE195869 Comparative analysis of genome-scale, base-resolution DNA methylation profiles across 580 animal species
Relations
BioSample SAMN25560652
SRA SRX14011287

Supplementary file Size Download File type/resource
GSM5852961_DOG_1_H_uc_cpgMeth.bed.gz 16.7 Mb (ftp)(http) BED
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap